Information

Tree census data for Sweden/Scandinavia?

Tree census data for Sweden/Scandinavia?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Is anyone aware of any attempts to count or approximate the number of trees there are in Sweden or Scandinavia? I have a small popular science side project for which this would be useful


I would definatley look at data from Swedish National Forest Inventory (Riksskogstaxeringen). They have time series data of multiple variables (DBH, size classes, species, dead wood etc) from plots all over the country. Extrapolations based on these data should produce reasonable estimates of total tree count, and probably the most accurate one that can be obtained at the moment. As an example, this report (in swedish) includes graphs on trees/km$^2$ for different species and areas (page 17 ff), but this is only based on areas that can support productive forestry.


Did a bit of a search, but could not find any Scandinavian specific statistics; however, I did find European Commission Forestry Statistics page, within this site there are some stats by country. Further, the website About Forestry in Northern European countries also has a few links to country based data.

I hope this helps.


Tree census data for Sweden/Scandinavia? - Biology

Children
Njord Odinsson I * King of Swedes b: ABT 0228 in Noatun, Sweden
Skjold Odinsson * 1st King of Denmark b: 0237 in Hleithra, Denmark
Beldeg Odinsson * Ancestor of Saxony b: 0243 in Ancient Saxony, Northern Germany
Overlord, Odin, also called Wodan, Woden, or Wotan, one of the principal gods in Norse mythology. His exact nature and role, however, are difficult to determine because of the complex picture of him given by the wealth of archaeological and literary sources. The Roman historian Tacitus stated that the Teutons worshiped Mercury and because dies Mercurii ("Mercury's day") was identified with Wednesday ("Woden's day"), there is little doubt that the god Woden (the earlier form of Odin) was meant. Though Woden was worshiped preeminently, there is not sufficient evidence of his cult to show whether it was practiced by all the Teutonic tribes or to enable conclusions to be drawn about the nature of the god. Later literary sources, however, indicate that at the end of the pre-Christian period Odin was the principal god in Scandinavia. From earliest times Odin was a war god, and he appeared in heroic literature as the protector of heroes fallen warriors joined him in Valhalla. The wolf and the raven were dedicated to him. His magical horse, Sleipnir, had eight legs, teeth inscribed with runes, and the ability to gallop through the air and over the sea. Odin was the great magician among the gods and was associated with runes. He was also the god of poets. In outward appearance he was a tall, old man, with flowing beard and only one eye (the other he gave in exchange for wisdom). He was usually depicted wearing a cloak and a wide-brimmed hat and carrying a spear. [Encyclopædia Britannica, 1961 ed., William Benton, Publisher, Chicago ©1961]. The Prose Edda shows the names of other sons who became the Kings of Denmark, Sweden and Norway, but I can't find analogues for these in the Anglo Saxon Chronicles. They are Skjöldr od Denmark, Saemingr of Norway and Yngvi of Sweden. [Brian Tompsett, Directory of Royal Genealogical Data, University of Hull, Hull, UK).

Early legendary kings of Denmark.

The kings of Denmark, like the Saxon, Norwegian, and Swedish rulers, all claim descent from Odin. Odin's real name, according to the old stories, was Sigge Fridulfson, but he called himself Odin so that people would worship him.

Odin is said to have come from Asgard, the legendary home of the gods. (Interestingly, the twelth-century Danish historian Saxo identifies Asgard with Byzantium.) Traveling north from Asgard in the first century AD, Odin allegedly founded the Kingdom of the Svear in Uppsala sometime before the Christian era.

King Odin, we are told, had five sons. They reigned over various parts of Scandinavia, and at least two of them ruled in Denmark. (One must remember that Denmark at that time included Skane. Although this region has belonged to Sweden in modern times, it was Danish from legendary through medieval times.) We shall not endeavor to mention all the legendary kings of Denmark, but rather highlight some of the more famous and interesting heroes of the sagas.

The Danish kings, like those of Norway and Sweden, did not always follow a direct line of succession from father to son. But they were required to be of noble blood, and they were elected by a gathering of nobles known as the "Thing". [Royal Families of Medieval Scandinavia, Flanders, and Kiev]

A. Early legendary kings of Denmark.

The kings of Denmark, like the Saxon, Norwegian, and Swedish rulers, all claim descent from Odin. Odin's real name, according to the old stories, was Sigge Fridulfson, but he called himself Odin so that people would worship him.

Odin is said to have come from Asgard, the legendary home of the gods. (Interestingly, the twelth-century Danish historian Saxo identifies Asgard with Byzantium.) Traveling north from Asgard in the first century AD, Odin allegedly founded the Kingdom of the Svear in Uppsala sometime before the Christian era.

King Odin, we are told, had five sons. They reigned over various parts of Scandinavia, and at least two of them ruled in Denmark. (One must remember that Denmark at that time included Skane. Although this region has belonged to Sweden in modern times, it was Danish from legendary through medieval times.) We shall not endeavor to mention all the legendary kings of Denmark, but rather highlight some of the more famous and interesting heroes of the sagas.

The Danish kings, like those of Norway and Sweden, did not always follow a direct line of succession from father to son. But they were required to be of noble blood, and they were elected by a gathering of nobles known as the "Thing". [Royal Families of Medieval Scandinavia, Flanders, and Kiev]

According to the geneology of the saxon kings of Wessex, recorded in the Anglo-saxon Chronicles, their ancestor, Woden, would have lived in the second christian century. Since the saxons practised hereditary kingship, Woden was evidently one in a line of warrior chieftains whose community survived the ages, into historical times. The most likely home of Woden's family was at Gudme, on the island of Fyn, off the east coast of Jutland in the Baltic Sea. There is a settlement there called 'Odense', which is said to mean: "Woden's sanctuary".
The first century settlement at Gudme, on the isle of Fyn, was at its most prosperous in the late roman iron age, from the years of Our Lord 200 to 300 (using the calendar popularised by Bede). So, it prospered initially towards the end of Woden's stuartship, and flourished for several generations afterwards.
Excavations there yield some of the most spectacular treasures of the age. The gold and silver trade goods, gold coins, jewel encrusted weapons, and masses of bog sacrifices, testify to an exceptionally favoured community. Somehow, the era of Woden came to be known as the days at the beginning of time. Woden's name, in particular, became associated with all the great traditions which survived from that era.
He was, according to tradition, the master of all poets. In the scandinavian custom, the poets were considered able to converse with the gods of Asgaard, the home of their ancestor heros. This high esteem for great poets was typical of all primitive western cultures, where the oral history of the tribes were preserved in epic verse. Influential poets would presumably be close relations of the chieftain.
The family of the chief warrior and the chief poet were royal in the most direct sense. They were extremely important men and women, who interpreted with wisdom all the events of our lives, and directed the community with authority.
A biography of kings entitled "Heimskringla", written in the early 1200's, credits Woden with having established the rites of worship and burial observed among the early scandinavians.
"He decreed that all the dead should be burned, and put on the funeral pyre with all their possessions. He also said that everyone should come into Valholl with all the property that he had on the pyre, and he should also enjoy the use of what he himself had buried in the earth, and the ashes should be carried out to sea or buried in the earth, and mounds should be raised in memory of men of rank.
And there should be a sacrifice at the beginning of winter for a successful year, and at midwinter for regeneration, and a third in summer which was a sacrifice for victory."
By the early middle ages, the local traditions of the late roman iron age had evolved into the religious traditions which we now associate with the viking people of the Baltic. The 10th century english chronicler, Aethelweard, says of Woden, the ancestor of the anglo-saxon kings, that "the unbelieving northerners (vikings) are overwhelmed by such great temptation that they worship him as a god even today."
So, the memory of Woden had evolved from that of ancestral chieftain, as held by the english, to that of a founding god in the norse pantheon of creation myth.[JohnFaye (8 Jun 05).FTW]

Overlord, Odin, also called Wodan, Woden, or Wotan, one of the principal gods in Norse mythology. His exact nature and role, however, are difficult to determine because of the complex picture of him given by the wealth of archaeological and literary sources. The Roman historian Tacitus stated that the Teutons worshiped Mercury and because dies Mercurii ("Mercury's day") was identified with Wednesday ("Woden's day"), there is little doubt that the god Woden (the earlier form of Odin) was meant. Though Woden was worshiped preeminently, there is not sufficient evidence of his cult to show whether it was practiced by all the Teutonic tribes or to enable conclusions to be drawn about the nature of the god. Later literary sources, however, indicate that at the end of the pre-Christian period Odin was the principal god in Scandinavia. From earliest times Odin was a war god, and he appeared in heroic literature as the protector of heroes fallen warriors joined him in Valhalla. The wolf and the raven were dedicated to him. His magical horse, Sleipnir, had eight legs, teeth inscribed with runes, and the ability to gallop through the air and over the sea. Odin was the great magician among the gods and was associated with runes. He was also the god of poets. In outward appearance he was a tall, old man, with flowing beard and only one eye (the other he gave in exchange for wisdom). He was usually depicted wearing a cloak and a wide-brimmed hat and carrying a spear. [Encyclopædia Britannica, 1961 ed., William Benton, Publisher, Chicago ©1961]. The Prose Edda shows the names of other sons who became the Kings of Denmark, Sweden and Norway, but I can't find analogues for these in the Anglo Saxon Chronicles. They are Skjöldr od Denmark, Saemingr of Norway and Yngvi of Sweden. [Brian Tompsett, Directory of Royal Genealogical Data, University of Hull, Hull, UK).

Early legendary kings of Denmark.

The kings of Denmark, like the Saxon, Norwegian, and Swedish rulers, all claim descent from Odin. Odin's real name, according to the old stories, was Sigge Fridulfson, but he called himself Odin so that people would worship him.

Odin is said to have come from Asgard, the legendary home of the gods. (Interestingly, the twelth-century Danish historian Saxo identifies Asgard with Byzantium.) Traveling north from Asgard in the first century AD, Odin allegedly founded the Kingdom of the Svear in Uppsala sometime before the Christian era.

King Odin, we are told, had five sons. They reigned over various parts of Scandinavia, and at least two of them ruled in Denmark. (One must remember that Denmark at that time included Skane. Although this region has belonged to Sweden in modern times, it was Danish from legendary through medieval times.) We shall not endeavor to mention all the legendary kings of Denmark, but rather highlight some of the more famous and interesting heroes of the sagas.

The Danish kings, like those of Norway and Sweden, did not always follow a direct line of succession from father to son. But they were required to be of noble blood, and they were elected by a gathering of nobles known as the "Thing". [Royal Families of Medieval Scandinavia, Flanders, and Kiev]

A. Early legendary kings of Denmark.

The kings of Denmark, like the Saxon, Norwegian, and Swedish rulers, all claim descent from Odin. Odin's real name, according to the old stories, was Sigge Fridulfson, but he called himself Odin so that people would worship him.

Odin is said to have come from Asgard, the legendary home of the gods. (Interestingly, the twelth-century Danish historian Saxo identifies Asgard with Byzantium.) Traveling north from Asgard in the first century AD, Odin allegedly founded the Kingdom of the Svear in Uppsala sometime before the Christian era.

King Odin, we are told, had five sons. They reigned over various parts of Scandinavia, and at least two of them ruled in Denmark. (One must remember that Denmark at that time included Skane. Although this region has belonged to Sweden in modern times, it was Danish from legendary through medieval times.) We shall not endeavor to mention all the legendary kings of Denmark, but rather highlight some of the more famous and interesting heroes of the sagas.

The Danish kings, like those of Norway and Sweden, did not always follow a direct line of succession from father to son. But they were required to be of noble blood, and they were elected by a gathering of nobles known as the "Thing". [Royal Families of Medieval Scandinavia, Flanders, and Kiev]

According to the geneology of the saxon kings of Wessex, recorded in the Anglo-saxon Chronicles, their ancestor, Woden, would have lived in the second christian century. Since the saxons practised hereditary kingship, Woden was evidently one in a line of warrior chieftains whose community survived the ages, into historical times. The most likely home of Woden's family was at Gudme, on the island of Fyn, off the east coast of Jutland in the Baltic Sea. There is a settlement there called 'Odense', which is said to mean: "Woden's sanctuary".
The first century settlement at Gudme, on the isle of Fyn, was at its most prosperous in the late roman iron age, from the years of Our Lord 200 to 300 (using the calendar popularised by Bede). So, it prospered initially towards the end of Woden's stuartship, and flourished for several generations afterwards.
Excavations there yield some of the most spectacular treasures of the age. The gold and silver trade goods, gold coins, jewel encrusted weapons, and masses of bog sacrifices, testify to an exceptionally favoured community. Somehow, the era of Woden came to be known as the days at the beginning of time. Woden's name, in particular, became associated with all the great traditions which survived from that era.
He was, according to tradition, the master of all poets. In the scandinavian custom, the poets were considered able to converse with the gods of Asgaard, the home of their ancestor heros. This high esteem for great poets was typical of all primitive western cultures, where the oral history of the tribes were preserved in epic verse. Influential poets would presumably be close relations of the chieftain.
The family of the chief warrior and the chief poet were royal in the most direct sense. They were extremely important men and women, who interpreted with wisdom all the events of our lives, and directed the community with authority.
A biography of kings entitled "Heimskringla", written in the early 1200's, credits Woden with having established the rites of worship and burial observed among the early scandinavians.
"He decreed that all the dead should be burned, and put on the funeral pyre with all their possessions. He also said that everyone should come into Valholl with all the property that he had on the pyre, and he should also enjoy the use of what he himself had buried in the earth, and the ashes should be carried out to sea or buried in the earth, and mounds should be raised in memory of men of rank.
And there should be a sacrifice at the beginning of winter for a successful year, and at midwinter for regeneration, and a third in summer which was a sacrifice for victory."
By the early middle ages, the local traditions of the late roman iron age had evolved into the religious traditions which we now associate with the viking people of the Baltic. The 10th century english chronicler, Aethelweard, says of Woden, the ancestor of the anglo-saxon kings, that "the unbelieving northerners (vikings) are overwhelmed by such great temptation that they worship him as a god even today."
So, the memory of Woden had evolved from that of ancestral chieftain, as held by the english, to that of a founding god in the norse pantheon of creation myth.

Father: Frithuwalk (Bor) Of Anglo Saxons b: ABT 190 in Asgard, Asia or East Europe
Mother: Beltsa Of Anglo-Saxons b: in Asgard, Asia or East Europe
Suggested Next Step:
Search OneWorldTree for:
Scandindavia, Odin King Of


Links & Resources

  • Wikipedia: Sweden
  • Cyndi's List: Sweden
  • General language translation tool(Google)
  • Rootsweb Message Board: Sweden( Please post your queries here! )
  • WGW: SwedenGenWeb (currently not accessible)
  • Mailing Lists: Sweden
  • FamilySearch: Sweden
  • Ancestry Data Collections: Sweden
  • JewishGen Scandinavia Database
  • FEEFHS: Sweden Resources
  • DIS Genealogical Society of Sweden (in Swedish)
  • Genealogiska Föreningen (The Genealogical Association of Sweden in Swedish)
  • Swedish Genealogy by ArkivDigital
  • Family Tree Magazine: Swedish Genealogy
  • The Swedish Genealogy Guide
  • Facebook Pages:
    • Swedish Genealogy Guide (see above)
    • Swedish American Genealogy Group
    • Swedish Genealogy
    • Scandinavian Genealogy Group
    • Northern Europe Genealogy Research Community

    For further in-depth genealogical research guidance please continue to our WorldGenWeb Country Partner or Country Link. Please note that while the WorldGenWeb project is free and does not even require registration, some partners/links may require a sign up and/or membership fees. Click the blue button to continue.


    Download and print this article for your personal scholarly, research, and educational use.

    Buy a single issue of Science for just $15 USD.

    Science

    Vol 335, Issue 6072
    02 March 2012

    Article Tools

    Please log in to add an alert for this article.

    By Laura Parducci , Tina Jørgensen , Mari Mette Tollefsrud , Ellen Elverland , Torbjørn Alm , Sonia L. Fontana , K. D. Bennett , James Haile , Irina Matetovici , Yoshihisa Suyama , Mary E. Edwards , Kenneth Andersen , Morten Rasmussen , Sanne Boessenkool , Eric Coissac , Christian Brochmann , Pierre Taberlet , Michael Houmark-Nielsen , Nicolaj Krog Larsen , Ludovic Orlando , M. Thomas P. Gilbert , Kurt H. Kjær , Inger Greve Alsos , Eske Willerslev

    Science 02 Mar 2012 : 1083-1086

    DNA from modern and ancient spruce and pine indicate that both survived in ice-free areas during the last glaciations.


    Clonal differences in susceptibility to the dieback of Fraxinus excelsior in southern Sweden

    Ash dieback damage was assessed and analysed on 16–22 year-old grafts in two ash seed orchards (Fraxinus excelsior L.). The grafts originated from 106 plus-tree clones selected from 27 stands in southern Sweden based on their phenotypes. The results obtained indicate that ash dieback disease is strongly genotypically controlled. There was considerable genotypic variation among individuals. None of the clones seemed to be totally resistant, but some exhibited reduced susceptibility and retained this resistance after 6 years under heavy infection pressure. Autumn phenology based on leaf coloration was subject to moderate genetic control (H 2 = 0.19). The genetic correlation between autumn phenology and damage was weak to moderate (r G from 0.38 to 0.60) and positive, indicating that susceptible clones have a prolonged growing season. There was no evidence suggesting that stands differed in susceptibility. Together with the high heritability of resistance, strong age×age correlations and weak genotype×environment interactions, this suggests there is good scope for breeding less susceptible trees for the future.

    Acknowledgements

    This study was funded by the Swedish Tree Breeding Association (Föreningen Skogsträdsförädling) and Nordic Forest Research Cooperation Committee (SNS), to whom I am very grateful. I also thank Bo Karlsson and Gunnar Jansson at the Forestry Research Institute of Sweden and Michelle Cleary at the Swedish University of Agricultural Sciences, Uppsala for valuable comments on the manuscript.


    Results and discussion

    We sequenced the genomes of seven hunter-gatherers from Scandinavia (Table 1 S1, S2 and S3 Text) ranging from 57.8× to 0.1× genome coverage, of which four individuals had a genome coverage above 1×. The remains were directly dated to between 9,500 cal BP and 6,000 cal BP, and were excavated in southwestern Norway (Hum1, Hum2), northern Norway (Steigen), and the Baltic islands of Stora Karlsö and Gotland (SF9, SF11, SF12, and SBj), and represent 18% (6 of 33) of all known human remains in Scandinavia older than 8,000 years [30]. All samples displayed fragmentation and cytosine deamination at fragment termini characteristic for ancient DNA (aDNA) (S3 Text). Mitochondrial (mt) DNA-based contamination estimates were <6% for all individuals (confidence intervals ranging from 0% to 9.5%) and autosomal contamination was <1% for all individuals except for SF11, which showed approximately 10% contamination (Table 1, S4 Text). Four of the seven individuals were inferred to be males and three were females. All the western and northern Scandinavian individuals and one eastern Scandinavian carried U5a1 mt haplotypes, whereas the remaining eastern Scandinavians carried U4a haplotypes (Table 1, S5 Text). These individuals represent the oldest U5a1 and U4 lineages detected so far. The Y chromosomal haplotype was determined for three of the four males, all carried I2 haplotypes, which were common in pre-Neolithic Europe (Table 1, S5 Text).

    The high coverage and Uracil-DNA-glycosylase (UDG)-treated genome (used in order to reduce the effects of postmortem DNA damage) [31] of SF12 allowed us to confidently discover new and hitherto unknown variants at sites with 55× or higher sequencing depth (S3 Text). Based on SF12’s high-coverage and high-quality genome, we estimate the number of SNPs hitherto unknown (not recorded in dbSNP [v142]) to be approximately 10,600. This number is close to the median per European individual in the 1000 Genomes Project [32] (approximately 11,400, S3 Text), although a direct comparison is difficult due to the lower sequencing depth, different data processing, and larger sample sizes in the 1000 Genomes Project. At least 17% of these SNPs that are not found in modern-day individuals were in fact common among the Mesolithic Scandinavians (seen in the low coverage data conditional on the observation in SF12), and in total 24.2% were found in other prehistoric individuals (S3 Text), suggesting a substantial amount of hitherto unknown variation 9,000 years ago (S3 Text). Thus, many genetic variants found in Mesolithic individuals have not been carried over to modern-day groups. Among the novel variants in SF12, four (all heterozygous) are predicted to affect the function of protein coding genes [33] (S3 Text). The “heat shock protein” HSPA2 in SF12 carries an unknown mutation that changes the amino acid histidine to tyrosine at a protein–protein interaction site, which likely disrupts the function of the protein (S3 Text). Defects in HSPA2 are known to drastically reduce fertility in males [34]. It will be interesting to see how common such variants were among Mesolithic groups as more genome sequence data become available. The genomic data further allowed us to study the physical appearance of SHGs (S8 Text) for instance, they show a combination of eye color varying from blue to light brown and light skin pigmentation. This is strikingly different from the WHGs—who have been suggested to have the specific combination of blue eyes and dark skin [18,20,21,23] and EHGs—who have been suggested to be brown-eyed and light-skinned [19,20].

    Demographic history of Mesolithic Scandinavians

    In order to compare the genomic sequence data of the seven SHGs to genetic information from other ancient individuals and modern-day groups, data were merged with shotgun sequence data and SNP capture data from six published Mesolithic individuals from Motala in central Scandinavia, and 47 published Stone Age (Upper Paleolithic, Mesolithic, and Early Neolithic) individuals from other parts of Eurasia (S6 Text) [17–22,26,27,29,35–38], as well as with a world-wide set of 203 modern-day populations [18,32,39]. All 13 SHGs—regardless of geographic sampling location and age—display genetic affinities to both WHGs and EHGs (Fig 1A and 1B, S6 Text). One individual, SF11, seems to be a slight genetic outlier in the principal component analysis (PCA), which could be due to the lower coverage or driven by nuclear contamination (Table 1, S6 Text). Generally, the pattern of dual ancestry is consistent with a scenario in which SHGs represent a mixed group tracing parts of their ancestry to both the WHGs and the EHGs [17–19,22,24,40].

    The SHGs from northern and western Scandinavia show a distinct and significantly stronger affinity to the EHGs compared to the central and eastern SHGs (Fig 1). Conversely, the SHGs from eastern and central Scandinavia were genetically more similar to WHGs compared to the northern and western SHGs (Fig 1). Using qpAdm [19], the EHG genetic component of northern and western SHGs was estimated to 48.9% (± 5%) and differs from the 37.8% (± 3.2%) observed in eastern and south-central SHGs. The latter estimate is similar to ancestry estimates obtained for eastern Baltic hunter-gatherers from Latvia [29] (33.7% ± 4.7%, Fig 1A). Although the difference in ancestry estimates between northern and western SHG, and eastern and south-central SHG is only marginally significant (Z = 1.87, p = 0.062), this pattern is in agreement with other analyses such as ADMIXTURE and TreeMix (S6 Text). Furthermore, the direct comparison using D statistics with Chimpanzee (Chimp) as an outgroup (D(Chimp, WHG eastern or south-central SHG, northern or western SHG) < 0, Z = −5.14 and D(Chimp, EHG eastern or south-central SHG, northern or western SHG) > 0, Z = 1.72) show that WHG are genetically closer to eastern and south-central SHG, whereas EHG tend to share more alleles with northern and western SHGs (S2 Fig). These patterns of genetic affinity within SHGs are in direct contrast to the expectation based on geographic proximity with EHGs and WHGs.

    From about 11,700 cal BP, consistent archaeological evidence of human presence exists in southern Scandinavia following the retreat of the ice sheet [6,41,42] (S1 Text). Artifacts and tools found at these sites show similarities with the Ahrensburgian tradition of northern central Europe [15,43], suggesting that these hunter-gatherers likely had a southern origin from a WHG-like gene pool as no EHG ancestry has been found in central and western Europe [18,21,24,27]. Although this genetic component would have entered from today’s northern Germany and Denmark (Fig 2, Scenario a), it remains unclear how and where the EHG component entered Scandinavia (Fig 2, Scenarios b, c and/or d). The EHG-related migration likely took place after the migration of WHGs from the south as the earliest eastern-associated pressure blade finds postdate the southwestern-associated direct blade finds in Scandinavia (S1 Text). Two migrations with admixture at different time-periods would generate a genetic gradient with the highest contribution of a source close to its geographic region of entry. The observed genetic pattern is consistent with a migration of the EHGs from the northeast moving southwards along the ice-free Norwegian Atlantic coast where the two groups started mixing (Fig 2, Scenarios a and b), which would cause more EHG ancestry in western SHGs. If the EHG migration had crossed the Baltic Sea into Scandinavia, where it would meet and mix with a WHG-like population (Fig 2, combination of Scenarios a and c), a gradient with most EHG ancestry in eastern SHGs would have been created—exactly opposite to the observed pattern. A similar pattern would be expected if the EHG migration went around the Baltic Sea along current day’s Finnish west coast and down via today’s Swedish east coast (scenario not depicted in Fig 2). An EHG migration along the southern Baltic coast (Fig 2, Scenarios a and d) should cause a related pattern to a crossing of the Baltic Sea with more EHG ancestry in central and eastern SHGs. Furthermore, such a scenario would likely also make the Latvian Mesolithic hunter-gatherers the group with most EHG ancestry, which is in stark contrast to the empirical data in which the Latvian group shows the lowest proportion of EHG ancestry (33.7% ± 4.7%), and also not consistent with chronology, as the dated settlements east of the Baltic Sea are younger than the early settlements in Scandinavia (S1 Text). Thus, the only scenario consistent with both genetic and archaeological data is a migration of a WHG-related group migrating into Scandinavia from the south, followed by an EHG-related group migrating to Scandinavia from the northeast along the Norwegian Atlantic coast. Notably, such a migration along the Norwegian coast could have been facilitated by the use of the more specialized pressure blade technique (S1 Text) [12,14]. The individuals sequenced here postdate these migrations, but a genetic east-west gradient would be maintained over time in Scandinavia and only additional large-scale migrations from different sources would alter this pattern. This observation is important as the geographic pattern still holds without the chronologically much younger Steigen individual, which might represent local continuity or later migrations into north-western Scandinavia from the east.


    The English term "Swede" has been attested in English since the late 16th century and is of Middle Dutch or Middle Low German origin. [34] In Swedish, the term is svensk, which is from the name of svear (or Swedes), the people who inhabited Svealand in eastern central Sweden, [35] [36] and were listed as Suiones in Tacitus' history Germania from the 1st century AD. The term is believed to have been derived from the Proto-Indo-European reflexive pronominal root, *s(w)e , as the Latin suus. The word must have meant "one's own (tribesmen)". The same root and original meaning is found in the ethnonym of the Germanic tribe Suebi, preserved to this day in the name Swabia. [37] [38] [39]

    Origins Edit

    Sweden enters proto-history with the Germania of Tacitus in 98 AD. In Germania 44, 45 he mentions the Swedes (Suiones) as a powerful tribe (distinguished not merely for their arms and men, but for their powerful fleets) with ships that had a prow in both ends (longships). Which kings (kuningaz) ruled these Suiones is unknown, but Norse mythology presents a long line of legendary and semi-legendary kings going back to the last centuries BC. As for literacy in Sweden itself, the runic script was in use among the south Scandinavian elite by at least the 2nd century AD, but all that has survived from the Roman Period is curt inscriptions on artefacts, mainly of male names, demonstrating that the people of south Scandinavia spoke Proto-Norse at the time, a language ancestral to Swedish and other North Germanic languages.

    In the 6th century Jordanes named two tribes, which he calls the Suehans and the Suetidi, who lived in Scandza. The Suehans, he says, have very fine horses just as the Thyringi tribe (alia vero gens ibi moratur Suehans, quae velud Thyringi equis utuntur eximiis). The Icelander Snorri Sturluson (1179–1241) wrote of the 6th-century Swedish king Adils (Eadgils) that he had the finest horses of his days. The Suehans supplied black fox-skins for the Roman market. Then Jordanes names the Suetidi which is considered to be the Latin form of Svitjod. He writes that the Suetidi are the tallest of men—together with the Dani, who were of the same stock. Later he mentions other Scandinavian tribes as being of the same height.

    Originating in semi-legendary Scandza (believed to be somewhere in modern Götaland, Sweden), a Gothic population had crossed the Baltic Sea before the 2nd century AD. They reaching Scythia on the coast of the Black Sea in modern Ukraine, where Goths left their archaeological traces in the Chernyakhov culture. In the 5th and 6th centuries, they became divided as the Visigoths and the Ostrogoths, and established powerful successor-states of the Roman Empire in the Iberian peninsula and Italy respectively. [40] Crimean Gothic communities appear to have survived intact in the Crimea until the late-18th century. [41]

    Viking and Middle Ages Edit

    The Swedish Viking Age lasted roughly between the 8th and 11th centuries. During this period, it is believed that the Swedes expanded from eastern Sweden and incorporated the Geats to the south. [42] It is believed that Swedish Vikings and Gutar mainly travelled east and south, going to Finland, the Baltic countries, Russia, Belarus, Ukraine the Black Sea and further as far as Baghdad. Their routes passed through the Dnieper down south to Constantinople, on which they did numerous raids. The Byzantine Emperor Theophilos noticed their great skills in war and invited them to serve as his personal bodyguard, known as the varangian guard. The Swedish Vikings, called "Rus" are also believed to be the founding fathers of Kievan Rus. The Arabic traveller Ibn Fadlan described these Vikings as following:

    I have seen the Rus as they came on their merchant journeys and encamped by the Itil. I have never seen more perfect physical specimens, tall as date palms, blond and ruddy they wear neither tunics nor caftans, but the men wear a garment which covers one side of the body and leaves a hand free. Each man has an axe, a sword, and a knife, and keeps each by him at all times. The swords are broad and grooved, of Frankish sort.

    The adventures of these Swedish Vikings are commemorated on many runestones in Sweden, such as the Greece Runestones and the Varangian Runestones. There was also considerable participation in expeditions westwards, which are commemorated on stones such as the England Runestones. The last major Swedish Viking expedition appears to have been the ill-fated expedition of Ingvar the Far-Travelled to Serkland, the region south-east of the Caspian Sea. Its members are commemorated on the Ingvar Runestones, none of which mentions any survivor. What happened to the crew is unknown, but it is believed that they died of sickness.

    Kingdom of Sweden Edit

    It is not known when and how the 'kingdom of Sweden' was born, but the list of Swedish monarchs is drawn from the first kings who ruled both Svealand (Sweden) and Götaland (Gothia) as one province with Erik the Victorious. Sweden and Gothia were two separate nations long before that into antiquity. It is not known how long they existed, but Beowulf described semi-legendary Swedish-Geatish wars in the 6th century.

    Cultural advances Edit

    During the early stages of the Scandinavian Viking Age, Ystad in Scania and Paviken on Gotland, in present-day Sweden, were flourishing trade centres. Remains of what is believed to have been a large market have been found in Ystad dating from 600 to 700 AD. [44] In Paviken, an important centre of trade in the Baltic region during the 9th and 10th centuries, remains have been found of a large Viking Age harbour with shipbuilding yards and handicraft industries. Between 800 and 1000, trade brought an abundance of silver to Gotland, and according to some scholars, the Gotlanders of this era hoarded more silver than the rest of the population of Scandinavia combined. [44]

    St. Ansgar is usually credited for introducing Christianity in 829, but the new religion did not begin to fully replace paganism until the 12th century. During the 11th century, Christianity became the most prevalent religion, and from 1050 Sweden is counted as a Christian nation. The period between 1100 and 1400 was characterized by internal power struggles and competition among the Nordic kingdoms. Swedish kings also began to expand the Swedish-controlled territory in Finland, creating conflicts with the Rus who no longer had any connection with Sweden. [45]

    Feudal institutions in Sweden Edit

    Except for the province of Skane, on the southernmost tip of Sweden which was under Danish control during this time, feudalism never developed in Sweden as it did in the rest of Europe. [46] Therefore, the peasantry remained largely a class of free farmers throughout most of Swedish history. Slavery (also called thralldom) was not common in Sweden, [47] and what slavery there was tended to be driven out of existence by the spread of Christianity, the difficulty in obtaining slaves from the lands east of the Baltic Sea, and by the development of cities before the 16th century [48] Indeed, both slavery and serfdom were abolished altogether by a decree of King Magnus Erickson in 1335. Former slaves tended to be absorbed into the peasantry and some became laborers in the towns. Still, Sweden remained a poor and economically backward country in which barter was the means of exchange. For instance, the farmers of the province of Dalsland would transport their butter to the mining districts of Sweden and exchange it there for iron, which they would then take down to the coast and trade the iron for fish they needed for food while the iron would be shipped abroad. [49]

    In the 14th century, Sweden was struck by the Black Death. The population of Sweden was decimated. [50] During this period the Swedish cities also began to acquire greater rights and were strongly influenced by German merchants of the Hanseatic League, active especially at Visby. In 1319, Sweden and Norway were united under King Magnus Eriksson, and in 1397 Queen Margaret I of Denmark effected the personal union of Sweden, Norway, and Denmark through the Kalmar Union. However, Margaret's successors, whose rule was also centred in Denmark, were unable to control the Swedish nobility.

    A large number of children inherited the Swedish crown over the course of the kingdom's existence, consequently—real power was held for long periods by regents (notably those of the Sture family) chosen by the Swedish parliament. King Christian II of Denmark, who asserted his claim to Sweden by force of arms, ordered a massacre in 1520 of Swedish nobles at Stockholm. This came to be known as the "Stockholm blood bath" and stirred the Swedish nobility to new resistance and, on 6 June (now Sweden's national holiday) in 1523, they made Gustav Vasa their king. [51] This is sometimes considered as the foundation of modern Sweden. Shortly afterwards he rejected Catholicism and led Sweden into the Protestant Reformation. Economically, Gustav Vasa broke the monopoly of the Hanseatic League over Swedish Baltic Sea trade. [52]

    The Hanseatic League had been officially formed at Lübeck on the sea coast of Northern Germany in 1356. The Hanseatic League sought civil and commercial privileges from the princes and royalty of the countries and cities along the coasts of the Baltic Sea. [53] In exchange they offered a certain amount of protection. Having their own navy the Hansa were able to sweep the Baltic Sea free of pirates. [54] The privileges obtained by the Hansa included assurances that only Hansa citizens would be allowed to trade from the ports where they were located. They also sought agreement to be free of all customs and taxes. With these concessions, Lübeck merchants flocked to Stockholm, Sweden and soon came to dominate the economic life of that city and made the port city of Stockholm into the leading commercial and industrial city of Sweden. [55] Under the Hanseatic trade two-thirds of Stockholm's imports consisted of textiles and one third of salt. Exports from Sweden consisted of iron and copper. [56]

    However, the Swedes began to resent the monopoly trading position of the Hansa (mostly German citizens) and to resent the income they felt they lost to the Hansa. Consequently, when Gustav Vasa or Gustav I broke the monopoly power of the Hanseatic League he was regarded as a hero to the Swedish people. History now views Gustav I as the father of the modern Swedish nation. The foundations laid by Gustav would take time to develop. Furthermore, when Sweden did develop and freed itself from the Hanseatic League and entered its golden era, the fact that the peasantry had traditionally been free meant that more of the economic benefits flowed back to them rather than going to a feudal landowning class. [57] This was not the case in other countries of Europe like Poland where the peasantry was still bound by serfdom and a strong feudalistic land owning system.

    Swedish Empire Edit

    During the 17th century Sweden emerged as a European great power. Before the emergence of the Swedish Empire, Sweden was a very poor and scarcely populated country on the fringe of European civilization, with no significant power or reputation. Sweden rose to prominence on a continental scale during the tenure of king Gustavus Adolphus, seizing territories from Russia and Poland–Lithuania in multiple conflicts, including the Thirty Years' War.

    During the Thirty Years' War, Sweden conquered approximately half of the Holy Roman states. Gustav Adolphus planned to become the new Holy Roman Emperor, ruling over a united Scandinavia and the Holy Roman states, but he died at the Battle of Lützen in 1632. After the Battle of Nördlingen, Sweden's only significant military defeat of the war, pro-Swedish sentiment among the German states faded. These German provinces excluded themselves from Swedish power one by one, leaving Sweden with only a few northern German territories: Swedish Pomerania, Bremen-Verden and Wismar. The Swedish armies may have destroyed up to 2,000 castles, 18,000 villages and 1,500 towns in Germany, one-third of all German towns. [58]

    In the middle of the 17th century Sweden was the third largest country in Europe by land area, only surpassed by Russia and Spain. Sweden reached its largest territorial extent under the rule of Charles X after the treaty of Roskilde in 1658. [59] [60] The foundation of Sweden's success during this period is credited to Gustav I's major changes on the Swedish economy in the 16th century, and his introduction of Protestantism. [61] In the 17th century, Sweden was engaged in many wars, for example with the Polish–Lithuanian Commonwealth with both sides competing for territories of today's Baltic states, with the disastrous Battle of Kircholm being one of the highlights. [62] One-third of the Finnish population died in the devastating famine that struck the country in 1696. [63] Famine also hit Sweden, killing roughly 10% of Sweden's population. [64]

    The Swedes conducted a series of invasions into the Polish–Lithuanian Commonwealth, known as the Deluge. After more than half a century of almost constant warfare, the Swedish economy had deteriorated. It became the lifetime task of Charles' son, Charles XI, to rebuild the economy and refit the army. His legacy to his son, the coming ruler of Sweden Charles XII, was one of the finest arsenals in the world, a large standing army and a great fleet. Sweden's largest threat at this time, Russia, had a larger army but was far behind in both equipment and training.

    After the Battle of Narva in 1700, one of the first battles of the Great Northern War, the Russian army was so severely decimated that Sweden had an open chance to invade Russia. However, Charles did not pursue the Russian army, instead turning against Poland–Lithuania and defeating the Polish king Augustus II and his Saxon allies at the Battle of Kliszow in 1702. This gave Russia time to rebuild and modernize its army.

    After the success of invading Poland, Charles decided to make an invasion attempt of Russia which ended in a decisive Russian victory at the Battle of Poltava in 1709. After a long march exposed to cossack raids, Russian Tsar Peter the Great's scorched-earth techniques and the extremely cold winter of 1709, the Swedes stood weakened with a shattered morale and enormously outnumbered against the Russian army at Poltava. The defeat meant the beginning of the end for the Swedish Empire.

    Charles XII attempted to invade Norway 1716 however, he was shot dead at Fredriksten fortress in 1718. The Swedes were not militarily defeated at Fredriksten, but the whole structure and organization of the Norwegian campaign fell apart with the king's death, and the army withdrew.

    Forced to cede large areas of land in the Treaty of Nystad in 1721, Sweden also lost its place as an empire and as the dominant state on the Baltic Sea. With Sweden's lost influence, Russia emerged as an empire and became one of Europe's dominant nations. As the war finally ended in 1721, Sweden had lost an estimated 200,000 men, 150,000 of those from the area of present-day Sweden and 50,000 from the Finnish part of Sweden. [65]

    In the 18th century, Sweden did not have enough resources to maintain its territories outside Scandinavia, and most of them were lost, culminating with the 1809 loss of eastern Sweden to Russia which became the highly autonomous Grand Principality of Finland in Imperial Russia.

    In interest of reestablishing Swedish dominance in the Baltic Sea, Sweden allied itself against its traditional ally and benefactor, France, in the Napoleonic Wars. Sweden's role in the Battle of Leipzig gave it the authority to force Denmark-Norway, an ally of France, to cede Norway to the King of Sweden on 14 January 1814 in exchange for northern German provinces, at the Treaty of Kiel. The Norwegian attempts to keep their status as a sovereign state were rejected by the Swedish king, Charles XIII. He launched a military campaign against Norway on 27 July 1814, ending in the Convention of Moss, which forced Norway into a personal union with Sweden under the Swedish crown, which lasted until 1905. The 1814 campaign was the last war in which Sweden participated as a combatant.

    Modern history Edit

    There was a significant population increase during the 18th and 19th centuries, which the writer Esaias Tegnér in 1833 attributed to "peace, vaccine, and potatoes". [66] Between 1750 and 1850, the population in Sweden doubled. Sweden was hit by the last natural caused famine in Europe, the Famine of 1867-69 killed thousands in Sweden. According to some scholars, mass emigration to America became the only way to prevent famine and rebellion over 1% of the population emigrated annually during the 1880s. [67] Nevertheless, Sweden remained poor, retaining a nearly entirely agricultural economy even as Denmark and Western European countries began to industrialize. [67] [68]

    Many looked towards America for a better life during this time. It is believed that between 1850 and 1910 more than one million Swedes moved to the United States. [69] In the early 20th century, more Swedes lived in Chicago than in Gothenburg (Sweden's second largest city). [70] Most Swedish immigrants moved to the Midwestern United States, with a large population in Minnesota, with a few others moving to other parts of the United States and Canada.

    Despite the slow rate of industrialization into the 19th century, many important changes were taking place in the agrarian economy because of innovations and the large population growth. [71] These innovations included government-sponsored programs of enclosure, aggressive exploitation of agricultural lands, and the introduction of new crops such as the potato. [71] Because the Swedish peasantry had never been enserfed as elsewhere in Europe, [72] the Swedish farming culture began to take on a critical role in the Swedish political process, which has continued through modern times with modern Agrarian party (now called the Centre Party). [73] Between 1870 and 1914, Sweden began developing the industrialized economy that exists today. [74]

    Strong grassroots movements sprung up in Sweden during the latter half of the 19th century (trade unions, temperance groups, and independent religious groups), creating a strong foundation of democratic principles. In 1889 The Swedish Social Democratic Party was founded. These movements precipitated Sweden's migration into a modern parliamentary democracy, achieved by the time of World War I. As the Industrial Revolution progressed during the 20th century, people gradually began moving into cities to work in factories and became involved in socialist unions. A communist revolution was avoided in 1917, following the re-introduction of parliamentarism, and the country saw comprehensive democratic reforms under the joint Liberal-Social Democrat cabinet of Nils Edén and Hjalmar Branting, with universal and equal suffrage to both houses of parliament enacted for men in 1918 and for women in 1919. The reforms were widely accepted by King Gustaf V, who had previously ousted Karl Staaff's elected Liberal government in the Courtyard Crisis because of differences in defence policy. It is possible that the Monarchy of Sweden survived because of the breakout of World War I, which saw a major shift in public sentiment towards the king's more pro-military views.

    World Wars Edit

    Sweden remained officially neutral during World War I and World War II, although its neutrality during World War II has been disputed. [75] [76] Sweden was under German influence for much of the war, as ties to the rest of the world were cut off through blockades. [75] The Swedish government felt that it was in no position to openly contest Germany, [77] and therefore made some concessions. [78] Sweden also supplied steel and machined parts to Germany throughout the war. However, Sweden supported Norwegian resistance, and in 1943 helped rescue Danish Jews from deportation to Nazi concentration camps. Sweden also supported Finland in the Winter War and the Continuation War with volunteers and materiel.

    Toward the end of the war, Sweden began to play a role in humanitarian efforts and many refugees, among them many Jews from Nazi-occupied Europe, were saved partly because of the Swedish involvement in rescue missions at the internment camps and partly because Sweden served as a haven for refugees, primarily from the Nordic countries and the Baltic states. [77] Nevertheless, internal and external critics have argued that Sweden could have done more to resist the Nazi war effort, even if risking occupation although doing so would likely have resulted in even greater number of casualties and prevented many humanitarian efforts. [77]

    Post-war era Edit

    Sweden was officially a neutral country and remained outside NATO or Warsaw pact membership during the Cold War, but privately Sweden's leadership had strong ties with the United States and other western governments.

    Following the war, Sweden took advantage of an intact industrial base, social stability and its natural resources to expand its industry to supply the rebuilding of Europe. [79] Sweden was part of the Marshall Plan and participated in the Organization of Economic Co-operation and Development (OECD). During most of the post-war era, the country was governed by the Swedish Social Democratic Party largely in cooperation with trade unions and industry. The government actively pursued an internationally competitive manufacturing sector of primarily large corporations. [80]

    Sweden, like countries around the globe, entered a period of economic decline and upheaval, following the oil embargoes of 1973–74 and 1978–79. [81] In the 1980s pillars of Swedish industry were massively restructured. Shipbuilding was discontinued, wood pulp was integrated into modernized paper production, the steel industry was concentrated and specialized, and mechanical engineering was robotized. [82]

    Between 1970 and 1990 the overall tax burden rose by over 10%, and the growth was low compared to other countries in Western Europe. The marginal income tax for workers reached over 80% [ citation needed ] . Eventually government spent over half of the country's gross domestic product. Sweden GDP per capita ranking declined during this time. [80]

    Recent history Edit

    A bursting real estate bubble caused by inadequate controls on lending combined with an international recession and a policy switch from anti-unemployment policies to anti-inflationary policies resulted in a fiscal crisis in the early 1990s. [83] Sweden's GDP declined by around 5%. In 1992, there was a run on the currency, with the central bank briefly increasing interest to 500%. [84] [85]

    The response of the government was to cut spending and institute a multitude of reforms to improve Sweden's competitiveness, among them reducing the welfare state and privatising public services and goods. Much of the political establishment promoted EU membership, and the Swedish referendum passed with 52% in favour of joining the EU on 13 November 1994. Sweden joined the European Union on 1 January 1995.

    Sweden remains non-aligned militarily, although it participates in some joint military exercises with NATO and some other countries, in addition to extensive cooperation with other European countries in the area of defence technology and defence industry. Among others, Swedish companies export weapons that are used by the American military in Iraq. [86] Sweden also has a long history of participating in international military operations, including most recently, Afghanistan, where Swedish troops are under NATO command, and in EU sponsored peacekeeping operations in Kosovo, Bosnia and Herzegovina, and Cyprus. Sweden held the chair of the European Union from 1 July to 31 December 2009.

    The growth of immigration to Sweden in the post-war era has triggered a debate in Sweden about the nature of "Swedishness" and how immigrants can be integrated in Swedish society. [87] In a report by the Swedish government it has been claimed that Swedishness usually is classified by researchers in five different ways: country of birth (i.e. Sweden), citizenship, consanguinity (i.e. perceived kinship), culture or language and appearance. It also claims that a mix of these ideas is found in more mundane uses of the word Swedish, in media and ordinary speech and that it should be understood in the light of how national stories of Sweden have been formed over a long period of time. [88]

    Sweden's main statistics bureau Statistics Sweden (SCB) does not keep any record of ethnicity, [89] but about 20% of Sweden's population is of foreign background. [90] Some immigrants in Sweden feel that they experience "betweenship" which arises when others ascribe them an identity that they do not hold themselves. [91]

    The growing numbers of immigrants has coincided with the rise of the anti-immigration political party Sweden Democrats which expresses concern of a demographic threat, especially the rise of Islam in Sweden. Since the 1990s, polls show that people in Sweden have gradually become more positive to asylum refugees. [92] However, in a poll made in 2019, a majority of Swedes expressed negative sentiments towards asylum seeking refugees. [93] Recently, the Sweden Democrats have become one of the most popular parties in Sweden which has sparked widespread debate about a possible increase of perceived xenophobia and racism in Sweden. [94]

    The native language of nearly all Swedes is Swedish ( svenska ( help · info ) ) a North Germanic language, spoken by approximately 10 million people, [95] predominantly in Sweden and parts of Finland, especially along its coast and on the Åland islands. It is, to a considerable extent, mutually intelligible with Norwegian and to a lesser extent with spoken Danish (see especially "Classification"). Along with the other North Germanic languages, Swedish is a descendant of Old Norse, the common language of the Germanic peoples living in Scandinavia during the Viking Era. It is the largest of the North Germanic languages by numbers of speakers.

    Standard Swedish, used by most Swedish people, is the national language that evolved from the Central Swedish dialects in the 19th century and was well established by the beginning of the 20th century. While distinct regional varieties descended from the older rural dialects still exist, the spoken and written language is uniform and standardized. Some dialects differ considerably from the standard language in grammar and vocabulary and are not always mutually intelligible with Standard Swedish. These dialects are confined to rural areas and are spoken primarily by small numbers of people with low social mobility. Though not facing imminent extinction, such dialects have been in decline during the past century, despite the fact that they are well researched and their use is often encouraged by local authorities.

    According to recent genetic analysis, both mtDNA and Y chromosome polymorphisms showed a noticeable genetic affinity between Swedes and other Germanic ethnic groups. [96] For the global genetic make-up of the Swedish people and other peoples, see [97] and. [98]

    Paternally, through their Y-DNA haplogroups, the Swedes are quite diverse and show strongly of Haplogroup I1d1 at over 40% of the population tested in different studies, followed by R1a1a and R1b1a2a1a1 with over 20% each and haplogroup N1c1 with over 5% at different regional variance. The rest are within haplogroups J and E1b1b1 and other less common ones. [97] [ citation needed ]

    Maternally, through their mtDNA haplogroups, the Swedes show very strongly of haplogroup H at 25–30%, followed by haplogroup U at a 10% or more, with haplogroup J and T, K at around 5% each. [ citation needed ]

    The largest area inhabited by Swedes, as well as the earliest known original area inhabited by their linguistic ancestors, is in the country of Sweden, situated on the eastern side of the Scandinavian Peninsula and the islands adjacent to it, situated west of the Baltic Sea in northern Europe. The Swedish-speaking people living in near-coastal areas on the north-eastern and eastern side of the Baltic Sea also have a long history of continuous settlement, which in some of these areas possibly started about a millennium ago [ citation needed ] . These people include the Swedish-speakers in mainland Finland – speaking a Swedish dialect commonly referred to as Finland Swedish (finlandssvenska which is part of the East-Swedish dialect group) and the almost exclusively Swedish-speaking population of the Åland Islands speaking in a manner closer to the adjacent dialects in Sweden than to adjacent dialects of Finland Swedish. Estonia also had an important Swedish minority which persisted for about 650 years on the coast and isles. Smaller groups of historical descendants of 18th–20th-century Swedish emigrants who still retain varying aspects of Swedish identity to this day can be found in the Americas (especially Minnesota and Wisconsin see Swedish Americans) and in Ukraine.

    Currently, Swedes tend to emigrate mostly to the Nordic neighbour countries (Norway, Denmark, Finland), English speaking countries (United States, United Kingdom, Australia, Canada, New Zealand), Spain and Germany. [99]

    Historically, the Kingdom of Sweden has been much larger than nowadays, especially during "The Era of Great Power" (Swedish Empire) in 1611–1718. Finland belonged to Sweden until 1809. Since there was no separate Finnish nationality at those times, it is not unusual that sources predating 1809 refer both to Swedes and Finns as "Swedes". This is particularly the case with New Sweden, where some of the Swedish settlers were of Finnish origin.

    According to a questionnaire survey conducted by Swedes Worldwide, a non-profit organization, Swedish embassies around the world reported figures for a total of 546,000 Swedish citizens living outside of Sweden. [3]


    Contents

    Copenhagen's name reflects its origin as a harbour and a place of commerce. The original designation in Old Norse, from which Danish descends, was Kaupmannahǫfn [ˈkaupmanːahɒvn] (cf. modern Icelandic: Kaupmannahöfn [ˈkʰøyhpmanːahœpn], Faroese Keypmannahavn), meaning "merchants' harbour". By the time Old Danish was spoken, the capital was called Køpmannæhafn, with the current name deriving from centuries of subsequent regular sound change. An exact English equivalent would be "chapman's haven". [9] However, the English term for the city was adapted from its Low German name, Kopenhagen. (English chapman, German Kaufmann, Dutch koopman, Swedish köpman, Danish købmand, Icelandic kaupmaður: in all these words, the first syllable comes ultimately from Latin caupo, "tradesman".) Copenhagen's Swedish name is Köpenhamn, a direct translation of the mutually intelligible Danish name.

    Early history Edit

    Although the earliest historical records of Copenhagen are from the end of the 12th century, recent archaeological finds in connection with work on the city's metropolitan rail system revealed the remains of a large merchant's mansion near today's Kongens Nytorv from c. 1020. Excavations in Pilestræde have also led to the discovery of a well from the late 12th century. The remains of an ancient church, with graves dating to the 11th century, have been unearthed near where Strøget meets Rådhuspladsen.

    These finds indicate that Copenhagen's origins as a city go back at least to the 11th century. Substantial discoveries of flint tools in the area provide evidence of human settlements dating to the Stone Age. [10] Many historians believe the town dates to the late Viking Age, and was possibly founded by Sweyn I Forkbeard. [11] The natural harbour and good herring stocks seem to have attracted fishermen and merchants to the area on a seasonal basis from the 11th century and more permanently in the 13th century. [12] The first habitations were probably centred on Gammel Strand (literally "old shore") in the 11th century or even earlier. [13]

    The earliest written mention of the town was in the 12th century when Saxo Grammaticus in Gesta Danorum referred to it as Portus Mercatorum, meaning Merchants' Harbour or, in the Danish of the time, Købmannahavn. [14] Traditionally, Copenhagen's founding has been dated to Bishop Absalon's construction of a modest fortress on the little island of Slotsholmen in 1167 where Christiansborg Palace stands today. [15] The construction of the fortress was in response to attacks by Wendish pirates who plagued the coastline during the 12th century. [16] Defensive ramparts and moats were completed and by 1177 St. Clemens Church had been built. Attacks by the Wends continued, and after the original fortress was eventually destroyed by the marauders, islanders replaced it with Copenhagen Castle. [17]

    Middle Ages Edit

    In 1186, a letter from Pope Urban III states that the castle of Hafn (Copenhagen) and its surrounding lands, including the town of Hafn, were given to Absalon, Bishop of Roskilde 1158–1191 and Archbishop of Lund 1177–1201, by King Valdemar I. On Absalon's death, the property was to come into the ownership of the Bishopric of Roskilde. [12] Around 1200, the Church of Our Lady was constructed on higher ground to the northeast of the town, which began to develop around it. [12]

    As the town became more prominent, it was repeatedly attacked by the Hanseatic League, and in 1368 successfully invaded during the Second Danish-Hanseatic War. As the fishing industry thrived in Copenhagen, particularly in the trade of herring, the city began expanding to the north of Slotsholmen. [16] In 1254, it received a charter as a city under Bishop Jakob Erlandsen [18] who garnered support from the local fishing merchants against the king by granting them special privileges. [19] In the mid 1330s, the first land assessment of the city was published. [19]

    With the establishment of the Kalmar Union (1397–1523) between Denmark, Norway and Sweden, by about 1416 Copenhagen had emerged as the capital of Denmark when Eric of Pomerania moved his seat to Copenhagen Castle. [20] [17] The University of Copenhagen was inaugurated on 1 June 1479 by King Christian I, following approval from Pope Sixtus IV. [21] This makes it the oldest university in Denmark and one of the oldest in Europe. Originally controlled by the Catholic Church, the university's role in society was forced to change during the Reformation in Denmark in the late 1530s. [21]

    16th and 17th centuries Edit

    In disputes prior to the Reformation of 1536, the city which had been faithful to Christian II, who was Catholic, was successfully besieged in 1523 by the forces of Frederik I, who supported Lutheranism. Copenhagen's defences were reinforced with a series of towers along the city wall. After an extended siege from July 1535 to July 1536, during which the city supported Christian II's alliance with Malmö and Lübeck, it was finally forced to capitulate to Christian III. During the second half of the century, the city prospered from increased trade across the Baltic supported by Dutch shipping. Christoffer Valkendorff, a high-ranking statesman, defended the city's interests and contributed to its development. [12] The Netherlands had also become primarily Protestant, as were northern German states.

    During the reign of Christian IV between 1588 and 1648, Copenhagen had dramatic growth as a city. On his initiative at the beginning of the 17th century, two important buildings were completed on Slotsholmen: the Tøjhus Arsenal and Børsen, the stock exchange. To foster international trade, the East India Company was founded in 1616. To the east of the city, inspired by Dutch planning, the king developed the district of Christianshavn with canals and ramparts. It was initially intended to be a fortified trading centre but ultimately became part of Copenhagen. [22] Christian IV also sponsored an array of ambitious building projects including Rosenborg Slot and the Rundetårn. [16] In 1658–59, the city withstood a siege by the Swedes under Charles X and successfully repelled a major assault. [22]

    By 1661, Copenhagen had asserted its position as capital of Denmark and Norway. All the major institutions were located there, as was the fleet and most of the army. The defences were further enhanced with the completion of the Citadel in 1664 and the extension of Christianshavns Vold with its bastions in 1692, leading to the creation of a new base for the fleet at Nyholm. [22] [23]

    18th century Edit

    Copenhagen lost around 22,000 of its population of 65,000 to the plague in 1711. [24] The city was also struck by two major fires that destroyed much of its infrastructure. [17] The Copenhagen Fire of 1728 was the largest in the history of Copenhagen. It began on the evening of 20 October, and continued to burn until the morning of 23 October, destroying approximately 28% of the city, leaving some 20% of the population homeless. No less than 47% of the medieval section of the city was completely lost. Along with the 1795 fire, it is the main reason that few traces of the old town can be found in the modern city. [25] [26]

    A substantial amount of rebuilding followed. In 1733, work began on the royal residence of Christiansborg Palace which was completed in 1745. In 1749, development of the prestigious district of Frederiksstaden was initiated. Designed by Nicolai Eigtved in the Rococo style, its centre contained the mansions which now form Amalienborg Palace. [27] Major extensions to the naval base of Holmen were undertaken while the city's cultural importance was enhanced with the Royal Theatre and the Royal Academy of Fine Arts. [28]

    In the second half of the 18th century, Copenhagen benefited from Denmark's neutrality during the wars between Europe's main powers, allowing it to play an important role in trade between the states around the Baltic Sea. After Christiansborg was destroyed by fire in 1794 and another fire caused serious damage to the city in 1795, work began on the classical Copenhagen landmark of Højbro Plads while Nytorv and Gammel Torv were converged. [28]

    19th century Edit

    On 2 April 1801, a British fleet under the command of Admiral Sir Hyde Parker attacked and defeated the neutral Danish-Norwegian fleet anchored near Copenhagen. Vice-Admiral Horatio Nelson led the main attack. [29] He famously disobeyed Parker's order to withdraw, destroying many of the Dano-Norwegian ships before a truce was agreed. [30] Copenhagen is often considered to be Nelson's hardest-fought battle, surpassing even the heavy fighting at Trafalgar. [31] It was during this battle that Lord Nelson was said to have "put the telescope to the blind eye" in order not to see Admiral Parker's signal to cease fire. [32]

    The Second Battle of Copenhagen (or the Bombardment of Copenhagen) (16 August – 5 September 1807) was from a British point of view a preemptive attack on Copenhagen, targeting the civilian population to yet again seize the Dano-Norwegian fleet. [33] But from a Danish point of view, the battle was a terror bombardment on their capital. Particularly notable was the use of incendiary Congreve rockets (containing phosphorus, which cannot be extinguished with water) that randomly hit the city. Few houses with straw roofs remained after the bombardment. The largest church, Vor frue kirke, was destroyed by the sea artillery. Several historians consider this battle the first terror attack against a major European city in modern times. [34] [35]

    The British landed 30,000 men, they surrounded Copenhagen and the attack continued for the next three days, killing some 2,000 civilians and destroying most of the city. [36] The devastation was so great because Copenhagen relied on an old defence-line whose limited range could not reach the British ships and their longer-range artillery. [37]

    Despite the disasters of the early 19th century, Copenhagen experienced a period of intense cultural creativity known as the Danish Golden Age. Painting prospered under C.W. Eckersberg and his students while C.F. Hansen and Gottlieb Bindesbøll brought a Neoclassical look to the city's architecture. [38] In the early 1850s, the ramparts of the city were opened to allow new housing to be built around The Lakes (Danish: Søerne) that bordered the old defences to the west. By the 1880s, the districts of Nørrebro and Vesterbro developed to accommodate those who came from the provinces to participate in the city's industrialization. This dramatic increase of space was long overdue, as not only were the old ramparts out of date as a defence system but bad sanitation in the old city had to be overcome. From 1886, the west rampart (Vestvolden) was flattened, allowing major extensions to the harbour leading to the establishment of the Freeport of Copenhagen 1892–94. [39] Electricity came in 1892 with electric trams in 1897. The spread of housing to areas outside the old ramparts brought about a huge increase in the population. In 1840, Copenhagen was inhabited by approximately 120,000 people. By 1901, it had some 400,000 inhabitants. [28]

    20th century Edit

    By the beginning of the 20th century, Copenhagen had become a thriving industrial and administrative city. With its new city hall and railway station, its centre was drawn towards the west. [28] New housing developments grew up in Brønshøj and Valby while Frederiksberg became an enclave within the city of Copenhagen. [40] The northern part of Amager and Valby were also incorporated into the City of Copenhagen in 1901–02. [41]

    As a result of Denmark's neutrality in the First World War, Copenhagen prospered from trade with both Britain and Germany while the city's defences were kept fully manned by some 40,000 soldiers for the duration of the war. [42]

    In the 1920s there were serious shortages of goods and housing. Plans were drawn up to demolish the old part of Christianshavn and to get rid of the worst of the city's slum areas. [43] However, it was not until the 1930s that substantial housing developments ensued, [44] with the demolition of one side of Christianhavn's Torvegade to build five large blocks of flats. [43]

    World War II Edit

    In Denmark during World War II, Copenhagen was occupied by German troops along with the rest of the country from 9 April 1940 until 4 May 1945. German leader Adolf Hitler hoped that Denmark would be "a model protectorate" [45] and initially the Nazi authorities sought to arrive at an understanding with the Danish government. The 1943 Danish parliamentary election was also allowed to take place, with only the Communist Party excluded. But in August 1943, after the government's collaboration with the occupation forces collapsed, several ships were sunk in Copenhagen Harbor by the Royal Danish Navy to prevent their use by the Germans. Around that time the Nazis started to arrest Jews, although most managed to escape to Sweden. [46]

    In 1945 Ole Lippman, leader of the Danish section of the Special Operations Executive, invited the British Royal Air Force to assist their operations by attacking Nazi headquarters in Copenhagen. Accordingly, air vice-marshal Sir Basil Embry drew up plans for a spectacular precision attack on the Sicherheitsdienst and Gestapo building, the former offices of the Shell Oil Company. Political prisoners were kept in the attic to prevent an air raid, so the RAF had to bomb the lower levels of the building. [47]

    The attack, known as "Operation Carthage", came on 22 March 1945, in three small waves. In the first wave, all six planes (carrying one bomb each) hit their target, but one of the aircraft crashed near Frederiksberg Girls School. Because of this crash, four of the planes in the two following waves assumed the school was the military target and aimed their bombs at the school, leading to the death of 123 civilians (of which 87 were schoolchildren). [47] However, 18 of the 26 political prisoners in the Shell Building managed to escape while the Gestapo archives were completely destroyed. [47]

    On 8 May 1945 Copenhagen was officially liberated by British troops commanded by Field Marshal Bernard Montgomery who supervised the surrender of 30,000 Germans situated around the capital. [48]

    Post-war decades Edit

    Shortly after the end of the war, an innovative urban development project known as the Finger Plan was introduced in 1947, encouraging the creation of new housing and businesses interspersed with large green areas along five "fingers" stretching out from the city centre along the S-train routes. [49] [50] With the expansion of the welfare state and women entering the work force, schools, nurseries, sports facilities and hospitals were established across the city. As a result of student unrest in the late 1960s, the former Bådsmandsstræde Barracks in Christianshavn was occupied, leading to the establishment of Freetown Christiania in September 1971. [51]

    Motor traffic in the city grew significantly and in 1972 the trams were replaced by buses. From the 1960s, on the initiative of the young architect Jan Gehl, pedestrian streets and cycle tracks were created in the city centre. [52] Activity in the port of Copenhagen declined with the closure of the Holmen Naval Base. Copenhagen Airport underwent considerable expansion, becoming a hub for the Nordic countries. In the 1990s, large-scale housing developments were realized in the harbour area and in the west of Amager. [44] The national library's Black Diamond building on the waterfront was completed in 1999. [53]

    Gallery Edit

    21st century Edit

    Since the summer of 2000, Copenhagen and the Swedish city of Malmö have been connected by the Øresund Bridge, which carries rail and road traffic. As a result, Copenhagen has become the centre of a larger metropolitan area spanning both nations. The bridge has brought about considerable changes in the public transport system and has led to the extensive redevelopment of Amager. [51] The city's service and trade sectors have developed while a number of banking and financial institutions have been established. Educational institutions have also gained importance, especially the University of Copenhagen with its 35,000 students. [54] Another important development for the city has been the Copenhagen Metro, the railway system which opened in 2002 with additions until 2007, transporting some 54 million passengers by 2011. [55]

    On the cultural front, the Copenhagen Opera House, a gift to the city from the shipping magnate Mærsk Mc-Kinney Møller on behalf of the A.P. Møller foundation, was completed in 2004. [56] In December 2009 Copenhagen gained international prominence when it hosted the worldwide climate meeting COP15. [57]

    Copenhagen is part of the Øresund Region, which consists of Zealand, Lolland-Falster and Bornholm in Denmark and Scania in Sweden. [58] It is located on the eastern shore of the island of Zealand, partly on the island of Amager and on a number of natural and artificial islets between the two. Copenhagen faces the Øresund to the east, the strait of water that separates Denmark from Sweden, and which connects the North Sea with the Baltic Sea. The Swedish towns of Malmö and Landskrona lie on the Swedish side of the sound directly across from Copenhagen. [59] By road, Copenhagen is 42 kilometres (26 mi) northwest of Malmö, Sweden, 85 kilometres (53 mi) northeast of Næstved, 164 kilometres (102 mi) northeast of Odense, 295 kilometres (183 mi) east of Esbjerg and 188 kilometres (117 mi) southeast of Aarhus by sea and road via Sjællands Odde. [60]

    The city centre lies in the area originally defined by the old ramparts, which are still referred to as the Fortification Ring (Fæstningsringen) and kept as a partial green band around it. [61] Then come the late-19th- and early-20th-century residential neighbourhoods of Østerbro, Nørrebro, Vesterbro and Amagerbro. The outlying areas of Kongens Enghave, Valby, Vigerslev, Vanløse, Brønshøj, Utterslev and Sundby followed from 1920 to 1960. They consist mainly of residential housing and apartments often enhanced with parks and greenery. [62]

    Topography Edit

    The central area of the city consists of relatively low-lying flat ground formed by moraines from the last ice age while the hilly areas to the north and west frequently rise to 50 m (160 ft) above sea level. The slopes of Valby and Brønshøj reach heights of over 30 m (98 ft), divided by valleys running from the northeast to the southwest. Close to the centre are the Copenhagen lakes of Sortedams Sø, Peblinge Sø and Sankt Jørgens Sø. [62]

    Copenhagen rests on a subsoil of flint-layered limestone deposited in the Danian period some 60 to 66 million years ago. Some greensand from the Selandian is also present. There are a few faults in the area, the most important of which is the Carlsberg fault which runs northwest to southeast through the centre of the city. [63] During the last ice age, glaciers eroded the surface leaving a layer of moraines up to 15 m (49 ft) thick. [64]

    Geologically, Copenhagen lies in the northern part of Denmark where the land is rising because of post-glacial rebound.

    Beaches Edit

    Amager Strandpark, which opened in 2005, is a 2 km (1 mi) long artificial island, with a total of 4.6 km (2.9 mi) of beaches. It is located just 15 minutes by bicycle or a few minutes by metro from the city centre. [65] In Klampenborg, about 10 kilometers from downtown Copenhagen, is Bellevue Beach. It is 700 metres (2,300 ft) long and has both lifeguards and freshwater showers on the beach. [66]

    The beaches are supplemented by a system of Harbour Baths along the Copenhagen waterfront. The first and most popular of these is located at Islands Brygge and has won international acclaim for its design. [67]

    Copenhagen is in the oceanic climate zone (Köppen: Cfb). [68] Its weather is subject to low-pressure systems from the Atlantic which result in unstable conditions throughout the year. Apart from slightly higher rainfall from July to September, precipitation is moderate. While snowfall occurs mainly from late December to early March, there can also be rain, with average temperatures around the freezing point. [69]

    June is the sunniest month of the year with an average of about eight hours of sunshine a day. July is the warmest month with an average daytime high of 21 °C. By contrast, the average hours of sunshine are less than two per day in November and only one and a half per day from December to February. In the spring, it gets warmer again with four to six hours of sunshine per day from March to May. February is the driest month of the year. [70] Exceptional weather conditions can bring as much as 50 cm of snow to Copenhagen in a 24-hour period during the winter months [71] while summer temperatures have been known to rise to heights of 33 °C (91 °F). [72]

    Because of Copenhagen's northern latitude, the number of daylight hours varies considerably between summer and winter. On the summer solstice, the sun rises at 04:26 and sets at 21:58, providing 17 hours 32 minutes of daylight. On the winter solstice, it rises at 08:37 and sets at 15:39 with 7 hours and 1 minute of daylight. There is therefore a difference of 10 hours and 31 minutes in the length of days and nights between the summer and winter solstices. [73]

    Climate data for Copenhagen, Denmark (1981–2010 normals, extremes 1768–present)
    Month Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Year
    Record high °C (°F) 11.8
    (53.2)
    15.8
    (60.4)
    20.8
    (69.4)
    26.2
    (79.2)
    28.5
    (83.3)
    32.7
    (90.9)
    33.0
    (91.4)
    33.8
    (92.8)
    29.8
    (85.6)
    23.2
    (73.8)
    17.0
    (62.6)
    12.8
    (55.0)
    33.8
    (92.8)
    Average high °C (°F) 3.4
    (38.1)
    3.6
    (38.5)
    6.5
    (43.7)
    11.8
    (53.2)
    16.7
    (62.1)
    19.6
    (67.3)
    22.2
    (72.0)
    21.8
    (71.2)
    17.5
    (63.5)
    12.6
    (54.7)
    7.6
    (45.7)
    4.4
    (39.9)
    12.3
    (54.1)
    Daily mean °C (°F) 1.4
    (34.5)
    1.4
    (34.5)
    3.5
    (38.3)
    7.7
    (45.9)
    12.5
    (54.5)
    15.6
    (60.1)
    18.1
    (64.6)
    17.7
    (63.9)
    13.9
    (57.0)
    9.8
    (49.6)
    5.5
    (41.9)
    2.5
    (36.5)
    9.1
    (48.4)
    Average low °C (°F) −0.7
    (30.7)
    −0.8
    (30.6)
    0.7
    (33.3)
    4.2
    (39.6)
    8.6
    (47.5)
    11.9
    (53.4)
    14.3
    (57.7)
    14.1
    (57.4)
    10.8
    (51.4)
    7.1
    (44.8)
    3.3
    (37.9)
    0.5
    (32.9)
    6.2
    (43.2)
    Record low °C (°F) −26.3
    (−15.3)
    −20.0
    (−4.0)
    −18.5
    (−1.3)
    −8.8
    (16.2)
    −3.4
    (25.9)
    1.0
    (33.8)
    0.7
    (33.3)
    0.6
    (33.1)
    −3.2
    (26.2)
    −7.0
    (19.4)
    −15.2
    (4.6)
    −16.0
    (3.2)
    −26.3
    (−15.3)
    Average precipitation mm (inches) 53.0
    (2.09)
    36.9
    (1.45)
    42.3
    (1.67)
    35.8
    (1.41)
    47.2
    (1.86)
    63.9
    (2.52)
    60.9
    (2.40)
    67.5
    (2.66)
    61.0
    (2.40)
    63.3
    (2.49)
    56.4
    (2.22)
    57.4
    (2.26)
    645.7
    (25.42)
    Average precipitation days (≥ 0.1 mm) 14.9 11.4 13.5 11.5 10.8 12.0 12.4 12.0 13.6 14.5 15.4 15.4 157.4
    Average snowy days 5.9 4.4 4.1 1.3 0.0 0.0 0.0 0.0 0.0 0.2 1.7 3.9 21.4
    Average relative humidity (%) 86 84 82 76 72 72 73 75 78 83 84 85 79
    Mean monthly sunshine hours 51.5 68.1 119.7 180.9 230.2 213.3 228.1 198.9 141.9 100.9 55.3 40.6 1,629.7
    Average ultraviolet index 0 1 2 3 5 6 5 5 3 1 1 0 3
    Source: DMI (precipitation days and snowy days 1971–2000, humidity 1961–1990), [74] [75] [76] Meteo Climat (record highs and lows) [77] and Weather Atlas [78]

    According to Statistics Denmark, the urban area of Copenhagen (Hovedstadsområdet) consists of the municipalities of Copenhagen, Frederiksberg, Albertslund, Brøndby, Gentofte, Gladsaxe, Glostrup, Herlev, Hvidovre, Lyngby-Taarbæk, Rødovre, Tårnby and Vallensbæk as well as parts of Ballerup, Rudersdal and Furesø municipalities, along with the cities of Ishøj and Greve Strand. [4] [79] They are located in the Capital Region (Region Hovedstaden). Municipalities are responsible for a wide variety of public services, which include land-use planning, environmental planning, public housing, management and maintenance of local roads, and social security. Municipal administration is also conducted by a mayor, a council, and an executive. [80]

    Copenhagen Municipality is by far the largest municipality, with the historic city at its core. The seat of Copenhagen's municipal council is the Copenhagen City Hall (Rådhus), which is situated on City Hall Square. The second largest municipality is Frederiksberg, an enclave within Copenhagen Municipality.

    Law and order Edit

    Most of Denmark's top legal courts and institutions are based in Copenhagen. A modern style court of justice, Hof- og Stadsretten, was introduced in Denmark, specifically for Copenhagen, by Johann Friedrich Struensee in 1771. [82] Now known as the City Court of Copenhagen (Københavns Byret), it is the largest of the 24 city courts in Denmark with jurisdiction over the municipalities of Copenhagen, Dragør and Tårnby. With its 42 judges, it has a Probate Division, an Enforcement Division and a Registration and Notorial Acts Division while bankruptcy is handled by the Maritime and Commercial Court of Copenhagen. [83] Established in 1862, the Maritime and Commercial Court (Sø- og Handelsretten) also hears commercial cases including those relating to trade marks, marketing practices and competition for the whole of Denmark. [84] Denmark's Supreme Court (Højesteret), located in Christiansborg Palace on Prins Jørgens Gård in the centre of Copenhagen, is the country's final court of appeal. Handling civil and criminal cases from the subordinate courts, it has two chambers which each hear all types of cases. [85]

    The Danish National Police and Copenhagen Police headquarters is situated in the Neoclassical-inspired Politigården building built in 1918–24 under architects Hack Kampmann and Holger Alfred Jacobsen. The building also contains administration, management, emergency department and radio service offices. [86] In their efforts to deal with drugs, the police have noted considerable success in the two special drug consumption rooms opened by the city where addicts can use sterile needles and receive help from nurses if necessary. Use of these rooms does not lead to prosecution the city treats drug use as a public health issue, not a criminal one. [87]

    The Copenhagen Fire Department forms the largest municipal fire brigade in Denmark with some 500 fire and ambulance personnel, 150 administration and service workers, and 35 workers in prevention. [88] The brigade began as the Copenhagen Royal Fire Brigade on 9 July 1687 under King Christian V. After the passing of the Copenhagen Fire Act on 18 May 1868, on 1 August 1870 the Copenhagen Fire Brigade became a municipal institution in its own right. [89] The fire department has its headquarters in the Copenhagen Central Fire Station which was designed by Ludvig Fenger in the Historicist style and inaugurated in 1892. [90]

    Environmental planning Edit

    Copenhagen is recognized as one of the most environmentally friendly cities in the world. [91] As a result of its commitment to high environmental standards, Copenhagen has been praised for its green economy, ranked as the top green city for the second time in the 2014 Global Green Economy Index (GGEI). [92] [93] In 2001 a large offshore wind farm was built just off the coast of Copenhagen at Middelgrunden. It produces about 4% of the city's energy. [94] Years of substantial investment in sewage treatment have improved water quality in the harbour to an extent that the inner harbour can be used for swimming with facilities at a number of locations. [95]

    Copenhagen aims to be carbon-neutral by 2025. Commercial and residential buildings are to reduce electricity consumption by 20 percent and 10 percent respectively, and total heat consumption is to fall by 20 percent by 2025. Renewable energy features such as solar panels are becoming increasingly common in the newest buildings in Copenhagen. District heating will be carbon-neutral by 2025, by waste incineration and biomass. New buildings must now be constructed according to Low Energy Class ratings and in 2020 near net-zero energy buildings. By 2025, 75% of trips should be made on foot, by bike, or by using public transit. The city plans that 20–30% of cars will run on electricity or biofuel by 2025. The investment is estimated at $472 million public funds and $4.78 billion private funds. [96]

    The city's urban planning authorities continue to take full account of these priorities. Special attention is given both to climate issues and efforts to ensure maximum application of low-energy standards. Priorities include sustainable drainage systems, [97] recycling rainwater, green roofs and efficient waste management solutions. In city planning, streets and squares are to be designed to encourage cycling and walking rather than driving. [98] Further, the city administration is working with smart city initiatives to improve how data and technology can be used to implement new solutions that support the transition toward a carbon-neutral economy. These solutions support operations covered by the city administration to improve e.g. public health, district heating, urban mobility and waste management systems. Smart city operations in Copenhagen are maintained by Copenhagen Solutions Lab, the city's official smart-city development unit under the Technical and Environmental Administration.

    Nationals
    by sub-national origin (Q1 2006) [99]
    Nationality Population
    Greenland 5,333
    Immigrants
    by country of origin (Top 15) (Q1 2020) [100]
    Nationality Population
    Pakistan 8,961
    Turkey 7,558
    Iraq 7,003
    Poland 6,280
    Germany 6,261
    Somalia 5,337
    Morocco 5,324
    Sweden 5,262
    Lebanon 5,019
    UK 4,940
    Norway 4,637
    Italy 4,323
    India 4,071
    Iran 4,038
    Mainland China 4,023

    Copenhagen is the most populous city in Denmark and one of the most populous in the Nordic countries. For statistical purposes, Statistics Denmark considers the City of Copenhagen (Byen København) to consist of the Municipality of Copenhagen plus three adjacent municipalities: Dragør, Frederiksberg, and Tårnby. [7] Their combined population stands at 763,908 (as of December 2016 [update] ). [8]

    The Municipality of Copenhagen is by far the most populous in the country and one of the most populous Nordic municipalities with 601,448 inhabitants (as of December 2016 [update] ). [4] There was a demographic boom in the 1990s and first decade of the 21st century, largely due to immigration to Denmark. According to figures from the first quarter of 2016, approximately 76% of the municipality's population was of Danish descent, [100] defined as having at least one parent who was born in Denmark and has Danish citizenship. Much of the remaining 24% were of a foreign background, defined as immigrants (18%) or descendants of recent immigrants (6%). [100] There are no official statistics on ethnic groups. The adjacent table shows the most common countries of birth of Copenhagen residents.

    According to Statistics Denmark, Copenhagen's urban area has a larger population of 1,280,371 (as of 1 January 2016 [update] ). [4] The urban area consists of the municipalities of Copenhagen and Frederiksberg plus 16 of the 20 municipalities of the former counties Copenhagen and Roskilde, though five of them only partially. [79] Metropolitan Copenhagen has a total of 2,016,285 inhabitants (as of 2016 [update] ). [4] The area of Metropolitan Copenhagen is defined by the Finger Plan. [101] Since the opening of the Øresund Bridge in 2000, commuting between Zealand and Scania in Sweden has increased rapidly, leading to a wider, integrated area. Known as the Øresund Region, it has 3.8 million inhabitants (of whom 2.5 million live in the Danish part of the region). [102]

    Religion Edit

    A majority (56.9%) of those living in Copenhagen are members of the Lutheran Church of Denmark which is 0.6% lower than one year earlier according to 2019 figures. [103] The National Cathedral, the Church of Our Lady, is one of the dozens of churches in Copenhagen. There are also several other Christian communities in the city, of which the largest is Roman Catholic. [104]

    Foreign migration to Copenhagen, rising over the last three decades, has contributed to increasing religious diversity the Grand Mosque of Copenhagen, the first in Denmark, opened in 2014. [105] Islam is the second largest religion in Copenhagen, accounting for approximately 10% of the population. [106] [107] [108] While there are no official statistics, a significant portion of the estimated 175,000–200,000 Muslims in the country live in the Copenhagen urban area, with the highest concentration in Nørrebro and the Vestegnen. [109] There are also some 7,000 Jews in Denmark, most of them in the Copenhagen area where there are several synagogues. [110] There is a long history of Jews in the city, and the first synagogue in Copenhagen was built in 1684. [111] Today, the history of the Jews of Denmark can be explored at the Danish Jewish Museum in Copenhagen.

    Quality of living Edit

    For a number of years, Copenhagen has ranked high in international surveys for its quality of life. Its stable economy together with its education services and level of social safety make it attractive for locals and visitors alike. Although it is one of the world's most expensive cities, it is also one of the most liveable with its public transport, facilities for cyclists and its environmental policies. [112] In elevating Copenhagen to "most liveable city" in 2013, Monocle pointed to its open spaces, increasing activity on the streets, city planning in favour of cyclists and pedestrians, and features to encourage inhabitants to enjoy city life with an emphasis on community, culture and cuisine. [113] Other sources have ranked Copenhagen high for its business environment, accessibility, restaurants and environmental planning. [114] However, Copenhagen ranks only 39th for student friendliness in 2012. Despite a top score for quality of living, its scores were low for employer activity and affordability. [115]

    Copenhagen is the major economic and financial centre of Denmark. The city's economy is based largely on services and commerce. Statistics for 2010 show that the vast majority of the 350,000 workers in Copenhagen are employed in the service sector, especially transport and communications, trade, and finance, while less than 10,000 work in the manufacturing industries. The public sector workforce is around 110,000, including education and healthcare. [116] From 2006 to 2011, the economy grew by 2.5% in Copenhagen, while it fell by some 4% in the rest of Denmark. [117] In 2017, the wider Capital Region of Denmark had a gross domestic product (GDP) of €120 billion, and the 15th largest GDP per capita of regions in the European Union. [118]

    Several financial institutions and banks have headquarters in Copenhagen, including Alm. Brand, Danske Bank, Nykredit and Nordea Bank Danmark. The Copenhagen Stock Exchange (CSE) was founded in 1620 and is now owned by Nasdaq, Inc.. Copenhagen is also home to a number of international companies including A.P. Møller-Mærsk, Novo Nordisk, Carlsberg and Novozymes. [119] City authorities have encouraged the development of business clusters in several innovative sectors, which include information technology, biotechnology, pharmaceuticals, clean technology and smart city solutions. [120] [121]

    Life science is a key sector with extensive research and development activities. Medicon Valley is a leading bi-national life sciences cluster in Europe, spanning the Øresund Region. Copenhagen is rich in companies and institutions with a focus on research and development within the field of biotechnology, [122] and the Medicon Valley initiative aims to strengthen this position and to promote cooperation between companies and academia. Many major Danish companies like Novo Nordisk and Lundbeck, both of which are among the 50 largest pharmaceutical and biotech companies in the world, are located in this business cluster. [123]

    Shipping is another import sector with Maersk, the world's largest shipping company, having their world headquarters in Copenhagen. The city has an industrial harbour, Copenhagen Port. Following decades of stagnation, it has experienced a resurgence since 1990 following a merger with Malmö harbour. Both ports are operated by Copenhagen Malmö Port (CMP). The central location in the Øresund Region allows the ports to act as a hub for freight that is transported onward to the Baltic countries. CMP annually receives about 8,000 ships and handled some 148,000 TEU in 2012. [124]

    Copenhagen has some of the highest gross wages in the world. [125] High taxes mean that wages are reduced after mandatory deduction. A beneficial researcher scheme with low taxation of foreign specialists has made Denmark an attractive location for foreign labour. It is however also among the most expensive cities in Europe. [126] [127]

    Denmark's Flexicurity model features some of the most flexible hiring and firing legislation in Europe, providing attractive conditions for foreign investment and international companies looking to locate in Copenhagen. [128] In Dansk Industri's 2013 survey of employment factors in the ninety-six municipalities of Denmark, Copenhagen came in first place for educational qualifications and for the development of private companies in recent years, but fell to 86th place in local companies' assessment of the employment climate. The survey revealed considerable dissatisfaction in the level of dialogue companies enjoyed with the municipal authorities. [129]

    Tourism Edit

    Tourism is a major contributor to Copenhagen's economy, attracting visitors due to the city's harbour, cultural attractions and award-winning restaurants. Since 2009, Copenhagen has been one of the fastest growing metropolitan destinations in Europe. [130] Hotel capacity in the city is growing significantly. From 2009 to 2013, it experienced a 42% growth in international bed nights (total number of nights spent by tourists), tallying a rise of nearly 70% for Chinese visitors. [130] The total number of bed nights in the Capital Region surpassed 9 million in 2013, while international bed nights reached 5 million. [130]

    In 2010, it is estimated that city break tourism contributed to DKK 2 billion in turnover. However, 2010 was an exceptional year for city break tourism and turnover increased with 29% in that one year. [131] 680,000 cruise passengers visited the port in 2015. [132] In 2019 Copenhagen was ranked first among Lonely Planet's top ten cities to visit. [133]

    The city's appearance today is shaped by the key role it has played as a regional centre for centuries. Copenhagen has a multitude of districts, each with its distinctive character and representing its own period. Other distinctive features of Copenhagen include the abundance of water, its many parks, and the bicycle paths that line most streets. [134]

    Architecture Edit

    The oldest section of Copenhagen's inner city is often referred to as Middelalderbyen (the medieval city). [135] However, the city's most distinctive district is Frederiksstaden, developed during the reign of Frederick V. It has the Amalienborg Palace at its centre and is dominated by the dome of Frederik's Church (or the Marble Church) and several elegant 18th-century Rococo mansions. [136] The inner city includes Slotsholmen, a little island on which Christiansborg Palace stands and Christianshavn with its canals. [137] Børsen on Slotsholmen and Frederiksborg Palace in Hillerød are prominent examples of the Dutch Renaissance style in Copenhagen. Around the historical city centre lies a band of congenial residential boroughs (Vesterbro, Inner Nørrebro, Inner Østerbro) dating mainly from late 19th century. They were built outside the old ramparts when the city was finally allowed to expand beyond its fortifications. [138]

    Sometimes referred to as "the City of Spires", Copenhagen is known for its horizontal skyline, broken only by the spires and towers of its churches and castles. Most characteristic of all is the Baroque spire of the Church of Our Saviour with its narrowing external spiral stairway that visitors can climb to the top. [139] Other important spires are those of Christiansborg Palace, the City Hall and the former Church of St. Nikolaj that now houses a modern art venue. Not quite so high are the Renaissance spires of Rosenborg Castle and the "dragon spire" of Christian IV's former stock exchange, so named because it resembles the intertwined tails of four dragons. [140]

    Copenhagen is recognised globally as an exemplar of best practice urban planning. [141] Its thriving mixed use city centre is defined by striking contemporary architecture, engaging public spaces and an abundance of human activity. These design outcomes have been deliberately achieved through careful replanning in the second half of the 20th century.

    Recent years have seen a boom in modern architecture in Copenhagen [142] both for Danish architecture and for works by international architects. For a few hundred years, virtually no foreign architects had worked in Copenhagen, but since the turn of the millennium the city and its immediate surroundings have seen buildings and projects designed by top international architects. British design magazine Monocle named Copenhagen the World's best design city 2008. [143]

    Copenhagen's urban development in the first half of the 20th century was heavily influenced by industrialisation. After World War II, Copenhagen Municipality adopted Fordism and repurposed its medieval centre to facilitate private automobile infrastructure in response to innovations in transport, trade and communication. [144] Copenhagen's spatial planning in this time frame was characterised by the separation of land uses: an approach which requires residents to travel by car to access facilities of different uses. [145]

    The boom in urban development and modern architecture has brought some changes to the city's skyline. A political majority has decided to keep the historical centre free of high-rise buildings, but several areas will see or have already seen massive urban development. Ørestad now has seen most of the recent development. Located near Copenhagen Airport, it currently boasts one of the largest malls in Scandinavia and a variety of office and residential buildings as well as the IT University and a high school. [146]

    Parks, gardens and zoo Edit

    Copenhagen is a green city with many parks, both large and small. King's Garden (Kongens Have), the garden of Rosenborg Castle, is the oldest and most frequented of them all. [147] It was Christian IV who first developed its landscaping in 1606. Every year it sees more than 2.5 million visitors [148] and in the summer months it is packed with sunbathers, picnickers and ballplayers. It serves as a sculpture garden with both a permanent display and temporary exhibits during the summer months. [147] Also located in the city centre are the Botanical Gardens noted for their large complex of 19th-century greenhouses donated by Carlsberg founder J. C. Jacobsen. [149] Fælledparken at 58 ha (140 acres) is the largest park in Copenhagen. [150]

    It is popular for sports fixtures and hosts several annual events including a free opera concert at the opening of the opera season, other open-air concerts, carnival and Labour Day celebrations, and the Copenhagen Historic Grand Prix, a race for antique cars. A historical green space in the northeastern part of the city is Kastellet, a well-preserved Renaissance citadel that now serves mainly as a park. [151] Another popular park is the Frederiksberg Gardens, a 32-hectare romantic landscape park. It houses a colony of tame grey herons and other waterfowl. [152] The park offers views of the elephants and the elephant house designed by world-famous British architect Norman Foster of the adjacent Copenhagen Zoo. [153] Langelinie, a park and promenade along the inner Øresund coast, is home to one of Copenhagen's most-visited tourist attractions, the Little Mermaid statue. [154]

    In Copenhagen, many cemeteries double as parks, though only for the more quiet activities such as sunbathing, reading and meditation. Assistens Cemetery, the burial place of Hans Christian Andersen, is an important green space for the district of Inner Nørrebro and a Copenhagen institution. The lesser known Vestre Kirkegaard is the largest cemetery in Denmark (54 ha (130 acres)) and offers a maze of dense groves, open lawns, winding paths, hedges, overgrown tombs, monuments, tree-lined avenues, lakes and other garden features. [155]

    It is official municipal policy in Copenhagen that by 2015 all citizens must be able to reach a park or beach on foot in less than 15 minutes. [156] In line with this policy, several new parks, including the innovative Superkilen in the Nørrebro district, have been completed or are under development in areas lacking green spaces. [157]

    Landmarks by district Edit

    Indre By Edit

    The historic centre of the city, Indre By or the Inner City, features many of Copenhagen's most popular monuments and attractions. The area known as Frederiksstaden, developed by Frederik V in the second half of the 18th century in the Rococo style, has the four mansions of Amalienborg, the royal residence, and the wide-domed Marble Church at its centre. [158] Directly across the water from Amalienborg, the recently completed Copenhagen Opera stands on the island of Holmen. [159] To the south of Frederiksstaden, the Nyhavn canal is lined with colourful houses from the 17th and 18th centuries, many now with lively restaurants and bars. [160] The canal runs from the harbour front to the spacious square of Kongens Nytorv which was laid out by Christian V in 1670. Important buildings include Charlottenborg Palace, famous for its art exhibitions, the Thott Palace (now the French embassy), the Royal Danish Theatre and the Hotel D'Angleterre, dated to 1755. [161] Other landmarks in Indre By include the parliament building of Christiansborg, the City Hall and Rundetårn, originally an observatory. There are also several museums in the area including Thorvaldsen Museum dedicated to the 18th-century sculptor Bertel Thorvaldsen. [162] Closed to traffic since 1964, Strøget, the world's oldest and longest pedestrian street, runs the 3.2 km (2.0 mi) from Rådhuspladsen to Kongens Nytorv. With its speciality shops, cafés, restaurants, and buskers, it is always full of life and includes the old squares of Gammel Torv and Amagertorv, each with a fountain. [163] Rosenborg Castle on Øster Voldgade was built by Christian IV in 1606 as a summer residence in the Renaissance style. It houses the Danish crown jewels and crown regalia, the coronation throne and tapestries illustrating Christian V's victories in the Scanian War. [164]

    Christianshavn Edit

    Christianshavn lies to the southeast of Indre By on the other side of the harbour. The area was developed by Christian IV in the early 17th century. Impressed by the city of Amsterdam, he employed Dutch architects to create canals within its ramparts which are still well preserved today. [22] The canals themselves, branching off the central Christianshavn Canal and lined with house boats and pleasure craft are one of the area's attractions. [165] Another interesting feature is Freetown Christiania, a fairly large area which was initially occupied by squatters during student unrest in 1971. Today it still maintains a measure of autonomy. The inhabitants openly sell drugs on "Pusher Street" as well as their arts and crafts. Other buildings of interest in Christianshavn include the Church of Our Saviour with its spiralling steeple and the magnificent Rococo Christian's Church. Once a warehouse, the North Atlantic House now displays culture from Iceland and Greenland and houses the Noma restaurant, known for its Nordic cuisine. [166] [167]

    Vesterbro Edit

    Vesterbro, to the southwest of Indre By, begins with the Tivoli Gardens, the city's top tourist attraction with its fairground atmosphere, its Pantomime Theatre, its Concert Hall and its many rides and restaurants. [168] The Carlsberg neighbourhood has some interesting vestiges of the old brewery of the same name including the Elephant Gate and the Ny Carlsberg Brewhouse. [169] The Tycho Brahe Planetarium is located on the edge of Skt. Jørgens Sø, one of the Copenhagen lakes. [170] Halmtorvet, the old haymarket behind the Central Station, is an increasingly popular area with its cafés and restaurants. The former cattle market Øksnehallen has been converted into a modern exhibition centre for art and photography. [171] Radisson Blu Royal Hotel, built by Danish architect and designer Arne Jacobsen for the airline Scandinavian Airlines System (SAS) between 1956 and 1960 was once the tallest hotel in Denmark with a height of 69.60 m (228.3 ft) and the city's only skyscraper until 1969. [172] Completed in 1908, Det Ny Teater (the New Theatre) located in a passage between Vesterbrogade and Gammel Kongevej has become a popular venue for musicals since its reopening in 1994, attracting the largest audiences in the country. [173]

    Nørrebro Edit

    Nørrebro to the northwest of the city centre has recently developed from a working-class district into a colourful cosmopolitan area with antique shops, non-Danish food stores and restaurants. Much of the activity is centred on Sankt Hans Torv [174] and around Rantzausgade. Copenhagen's historic cemetery, Assistens Kirkegård halfway up Nørrebrogade, is the resting place of many famous figures including Søren Kierkegaard, Niels Bohr, and Hans Christian Andersen but is also used by locals as a park and recreation area. [175]

    Østerbro Edit

    Just north of the city centre, Østerbro is an upper middle-class district with a number of fine mansions, some now serving as embassies. [176] The district stretches from Nørrebro to the waterfront where The Little Mermaid statue can be seen from the promenade known as Langelinie. Inspired by Hans Christian Andersen's fairy tale, it was created by Edvard Eriksen and unveiled in 1913. [177] Not far from the Little Mermaid, the old Citadel (Kastellet) can be seen. Built by Christian IV, it is one of northern Europe's best preserved fortifications. There is also a windmill in the area. [178] The large Gefion Fountain (Gefionspringvandet) designed by Anders Bundgaard and completed in 1908 stands close to the southeast corner of Kastellet. Its figures illustrate a Nordic legend. [179]

    Frederiksberg Edit

    Frederiksberg, a separate municipality within the urban area of Copenhagen, lies to the west of Nørrebro and Indre By and north of Vesterbro. Its landmarks include Copenhagen Zoo founded in 1869 with over 250 species from all over the world and Frederiksberg Palace built as a summer residence by Frederick IV who was inspired by Italian architecture. Now a military academy, it overlooks the extensive landscaped Frederiksberg Gardens with its follies, waterfalls, lakes and decorative buildings. [180] The wide tree-lined avenue of Frederiksberg Allé connecting Vesterbrogade with the Frederiksberg Gardens has long been associated with theatres and entertainment. While a number of the earlier theatres are now closed, the Betty Nansen Theatre and Aveny-T are still active. [181]

    Amagerbro Edit

    Amagerbro (also known as Sønderbro) is the district located immediately south-east of Christianshavn at northernmost Amager. The old city moats and their surrounding parks constitute a clear border between these districts. The main street is Amagerbrogade which after the harbour bridge Langebro, is an extension of H. C. Andersens Boulevard and has a number of various stores and shops as well as restaurants and pubs. [182] Amagerbro was built up during the two first decades of the twentieth century and is the city's northernmost block built area with typically 4–7 floors. Further south follows the Sundbyøster and Sundbyvester districts. [183]

    Other districts Edit

    Not far from Copenhagen Airport on the Kastrup coast, The Blue Planet completed in March 2013 now houses the national aquarium. With its 53 aquariums, it is the largest facility of its kind in Scandinavia. [184] Grundtvig's Church, located in the northern suburb of Bispebjerg, was designed by P.V. Jensen Klint and completed in 1940. A rare example of Expressionist church architecture, its striking west façade is reminiscent of a church organ. [185]

    Apart from being the national capital, Copenhagen also serves as the cultural hub of Denmark and wider Scandinavia. Since the late 1990s, it has undergone a transformation from a modest Scandinavian capital into a metropolitan city of international appeal in the same league as Barcelona and Amsterdam. [186] This is a result of huge investments in infrastructure and culture as well as the work of successful new Danish architects, designers and chefs. [142] [187] Copenhagen Fashion Week, the largest fashion event in Northern Europe, takes place every year in February and August. [188] [189]

    Museums Edit

    Copenhagen has a wide array of museums of international standing. The National Museum, Nationalmuseet, is Denmark's largest museum of archaeology and cultural history, comprising the histories of Danish and foreign cultures alike. [190] Denmark's National Gallery (Statens Museum for Kunst) is the national art museum with collections dating from the 12th century to the present. In addition to Danish painters, artists represented in the collections include Rubens, Rembrandt, Picasso, Braque, Léger, Matisse, Emil Nolde, Olafur Eliasson, Elmgreen and Dragset, Superflex and Jens Haaning. [191]

    Another important Copenhagen art museum is the Ny Carlsberg Glyptotek founded by second generation Carlsberg philanthropist Carl Jacobsen and built around his personal collections. Its main focus is classical Egyptian, Roman and Greek sculptures and antiquities and a collection of Rodin sculptures, the largest outside France. Besides its sculpture collections, the museum also holds a comprehensive collection of paintings of Impressionist and Post-Impressionist painters such as Monet, Renoir, Cézanne, van Gogh and Toulouse-Lautrec as well as works by the Danish Golden Age painters. [192]

    Louisiana is a Museum of Modern Art situated on the coast just north of Copenhagen. It is located in the middle of a sculpture garden on a cliff overlooking Øresund. Its collection of over 3,000 items includes works by Picasso, Giacometti and Dubuffet. [193] The Danish Design Museum is housed in the 18th-century former Frederiks Hospital and displays Danish design as well as international design and crafts. [194]

    Other museums include: the Thorvaldsens Museum, dedicated to the oeuvre of romantic Danish sculptor Bertel Thorvaldsen who lived and worked in Rome [195] the Cisternerne museum, an exhibition space for contemporary art, located in former cisterns that come complete with stalactites formed by the changing water levels [196] and the Ordrupgaard Museum, located just north of Copenhagen, which features 19th-century French and Danish art and is noted for its works by Paul Gauguin. [197]

    Entertainment and performing arts Edit

    The new Copenhagen Concert Hall opened in January 2009. Designed by Jean Nouvel, it has four halls with the main auditorium seating 1,800 people. It serves as the home of the Danish National Symphony Orchestra and along with the Walt Disney Concert Hall in Los Angeles is the most expensive concert hall ever built. [198] Another important venue for classical music is the Tivoli Concert Hall located in the Tivoli Gardens. [199] Designed by Henning Larsen, the Copenhagen Opera House (Operaen) opened in 2005. It is among the most modern opera houses in the world. [200] The Royal Danish Theatre also stages opera in addition to its drama productions. It is also home to the Royal Danish Ballet. Founded in 1748 along with the theatre, it is one of the oldest ballet troupes in Europe, and is noted for its Bournonville style of ballet. [201]

    Copenhagen has a significant jazz scene that has existed for many years. It developed when a number of American jazz musicians such as Ben Webster, Thad Jones, Richard Boone, Ernie Wilkins, Kenny Drew, Ed Thigpen, Bob Rockwell, Dexter Gordon, and others such as rock guitarist Link Wray came to live in Copenhagen during the 1960s. Every year in early July, Copenhagen's streets, squares, parks as well as cafés and concert halls fill up with big and small jazz concerts during the Copenhagen Jazz Festival. One of Europe's top jazz festivals, the annual event features around 900 concerts at 100 venues with over 200,000 guests from Denmark and around the world. [202]

    The largest venue for popular music in Copenhagen is Vega in the Vesterbro district. It was chosen as "best concert venue in Europe" by international music magazine Live. The venue has three concert halls: the great hall, Store Vega, accommodates audiences of 1,550, the middle hall, Lille Vega, has space for 500 and Ideal Bar Live has a capacity of 250. [203] Every September since 2006, the Festival of Endless Gratitude (FOEG) has taken place in Copenhagen. This festival focuses on indie counterculture, experimental pop music and left field music combined with visual arts exhibitions. [204]

    For free entertainment one can stroll along Strøget, especially between Nytorv and Højbro Plads, which in the late afternoon and evening is a bit like an impromptu three-ring circus with musicians, magicians, jugglers and other street performers. [205]

    Literature Edit

    Most of Denmarks's major publishing houses are based in Copenhagen. [206] These include the book publishers Gyldendal and Akademisk Forlag and newspaper publishers Berlingske and Politiken (the latter also publishing books). [207] [208] Many of the most important contributors to Danish literature such as Hans Christian Andersen (1805–1875) with his fairy tales, the philosopher Søren Kierkegaard (1813–1855) and playwright Ludvig Holberg (1684–1754) spent much of their lives in Copenhagen. Novels set in Copenhagen include Baby (1973) by Kirsten Thorup, The Copenhagen Connection (1982) by Barbara Mertz, Number the Stars (1989) by Lois Lowry, Miss Smilla's Feeling for Snow (1992) and Borderliners (1993) by Peter Høeg, Music and Silence (1999) by Rose Tremain, The Danish Girl (2000) by David Ebershoff, and Sharpe's Prey (2001) by Bernard Cornwell. Michael Frayn's 1998 play Copenhagen about the meeting between the physicists Niels Bohr and Werner Heisenberg in 1941 is also set in the city. On 15–18 August 1973, an oral literature conference took place in Copenhagen as part of the 9th International Congress of Anthropological and Ethnological Sciences. [209]

    The Royal Library, belonging to the University of Copenhagen, is the largest library in the Nordic countries with an almost complete collection of all printed Danish books since 1482. Founded in 1648, the Royal Library is located at four sites in the city, the main one being on the Slotsholmen waterfront. [210] Copenhagen's public library network has over 20 outlets, the largest being the Central Library (Københavns Hovedbibliotek) on Krystalgade in the inner city. [211]

    Art Edit

    Copenhagen has a wide selection of art museums and galleries displaying both historic works and more modern contributions. They include Statens Museum for Kunst, i.e. the Danish national art gallery, in the Østre Anlæg park, and the adjacent Hirschsprung Collection specialising in the 19th and early 20th century. Kunsthal Charlottenborg in the city centre exhibits national and international contemporary art. Den Frie Udstilling near the Østerport Station exhibits paintings created and selected by contemporary artists themselves rather than by the official authorities. The Arken Museum of Modern Art is located in southwestern Ishøj. [212] Among artists who have painted scenes of Copenhagen are Martinus Rørbye (1803–1848), [213] Christen Købke (1810–1848) [214] and the prolific Paul Gustav Fischer (1860–1934). [215]

    A number of notable sculptures can be seen in the city. In addition to The Little Mermaid on the waterfront, there are two historic equestrian statues in the city centre: Jacques Saly's Frederik V on Horseback (1771) in Amalienborg Square [216] and the statue of Christian V on Kongens Nytorv created by Abraham-César Lamoureux in 1688 who was inspired by the statue of Louis XIII in Paris. [217] Rosenborg Castle Gardens contains several sculptures and monuments including August Saabye's Hans Christian Andersen, Aksel Hansen's Echo, and Vilhelm Bissen's Dowager Queen Caroline Amalie. [218]

    Copenhagen is believed to have invented the photomarathon photography competition, which has been held in the City each year since 1989. [219] [220]

    Cuisine Edit

    As of 2014 [update] , Copenhagen has 15 Michelin-starred restaurants, the most of any Scandinavian city. [221] The city is increasingly recognized internationally as a gourmet destination. [222] These include Den Røde Cottage, Formel B Restaurant, Grønbech & Churchill, Søllerød Kro, Kadeau, Kiin Kiin (Denmark's first Michelin-starred Asian gourmet restaurant), the French restaurant Kong Hans Kælder, Relæ, Restaurant AOC, Noma (short for Danish: nordisk mad, English: Nordic food) with two Stars and Geranium with three. Noma, was ranked as the Best Restaurant in the World by Restaurant in 2010, 2011, 2012, and again in 2014, [223] sparking interest in the New Nordic Cuisine. [224]

    Apart from the selection of upmarket restaurants, Copenhagen offers a great variety of Danish, ethnic and experimental restaurants. It is possible to find modest eateries serving open sandwiches, known as smørrebrød – a traditional, Danish lunch dish however, most restaurants serve international dishes. [225] Danish pastry can be sampled from any of numerous bakeries found in all parts of the city. The Copenhagen Baker's Association dates back to the 1290s and Denmark's oldest confectioner's shop still operating, Conditori La Glace, was founded in 1870 in Skoubogade by Nicolaus Henningsen, a trained master baker from Flensburg. [226]

    Copenhagen has long been associated with beer. Carlsberg beer has been brewed at the brewery's premises on the border between the Vesterbro and Valby districts since 1847 and has long been almost synonymous with Danish beer production. However, recent years have seen an explosive growth in the number of microbreweries so that Denmark today has more than 100 breweries, many of which are located in Copenhagen. Some like Nørrebro Bryghus also act as brewpubs where it is also possible to eat on the premises. [227] [228]

    Nightlife and festivals Edit

    Copenhagen has one of the highest number of restaurants and bars per capita in the world. [229] The nightclubs and bars stay open until 5 or 6 in the morning, some even longer. Denmark has a very liberal alcohol culture and a strong tradition for beer breweries, although binge drinking is frowned upon and the Danish Police take driving under the influence very seriously. [230] Inner city areas such as Istedgade and Enghave Plads in Vesterbro, Sankt Hans Torv in Nørrebro and certain places in Frederiksberg are especially noted for their nightlife. Notable nightclubs include Bakken Kbh, ARCH (previously ZEN), Jolene, The Jane, Chateau Motel, KB3, At Dolores (previously Sunday Club), Rust, Vega Nightclub, Culture Box and Gefährlich, which also serves as a bar, café, restaurant, and art gallery. [231] [232]

    Copenhagen has several recurring community festivals, mainly in the summer. Copenhagen Carnival has taken place every year since 1982 during the Whitsun Holiday in Fælledparken and around the city with the participation of 120 bands, 2,000 dancers and 100,000 spectators. [233] Since 2010, the old B&W Shipyard at Refshaleøen in the harbour has been the location for Copenhell, a heavy metal rock music festival. Copenhagen Pride is a gay pride festival taking place every year in August. The Pride has a series of different activities all over Copenhagen, but it is at the City Hall Square that most of the celebration takes place. During the Pride the square is renamed Pride Square. [234] Copenhagen Distortion has emerged to be one of the biggest street festivals in Europe with 100,000 people joining to parties in the beginning of June every year.

    Amusement parks Edit

    Copenhagen has the two oldest amusement parks in the world. [235] [236]

    Dyrehavsbakken, a fair-ground and pleasure-park established in 1583, is located in Klampenborg just north of Copenhagen in a forested area known as Dyrehaven. Created as an amusement park complete with rides, games and restaurants by Christian IV, it is the oldest surviving amusement park in the world. [235] Pierrot (Danish: Pjerrot), a nitwit dressed in white with a scarlet grin wearing a boat-like hat while entertaining children, remains one of the park's key attractions. In Danish, Dyrehavsbakken is often abbreviated as Bakken. There is no entrance fee to pay and Klampenborg Station on the C-line, is situated nearby. [237]

    The Tivoli Gardens is an amusement park and pleasure garden located in central Copenhagen between the City Hall Square and the Central Station. It opened in 1843, making it the second oldest amusement park in the world. Among its rides are the oldest still operating rollercoaster Rutschebanen from 1915 and the oldest ferris wheel still in use, opened in 1943. [238] Tivoli Gardens also serves as a venue for various performing arts and as an active part of the cultural scene in Copenhagen. [239]

    Copenhagen has over 94,000 students enrolled in its largest universities and institutions: University of Copenhagen (38,867 students), [240] Copenhagen Business School (19,999 students), [241] Metropolitan University College and University College Capital (10,000 students each), [242] Technical University of Denmark (7,000 students), [243] KEA (c. 4,500 students), [244] IT University of Copenhagen (2,000 students) and Aalborg University – Copenhagen (2,300 students). [245]

    The University of Copenhagen is Denmark's oldest university founded in 1479. It attracts some 1,500 international and exchange students every year. The Academic Ranking of World Universities placed it 30th in the world in 2016. [246]

    The Technical University of Denmark is located in Lyngby in the northern outskirts of Copenhagen. In 2013, it was ranked as one of the leading technical universities in Northern Europe. [247] The IT University is Denmark's youngest university, a mono-faculty institution focusing on technical, societal and business aspects of information technology. [248]

    The Danish Academy of Fine Arts has provided education in the arts for more than 250 years. It includes the historic School of Visual Arts, and has in later years come to include a School of Architecture, a School of Design and a School of Conservation. [249] Copenhagen Business School (CBS) is an EQUIS-accredited business school located in Frederiksberg. [250] There are also branches of both University College Capital and Metropolitan University College inside and outside Copenhagen. [251] [252]

    The city has a variety of sporting teams. The major football teams are the historically successful FC København [253] and Brøndby. FC København plays at Parken in Østerbro. Formed in 1992, it is a merger of two older Copenhagen clubs, B 1903 (from the inner suburb Gentofte) and KB (from Frederiksberg). [254] Brøndby plays at Brøndby Stadion in the inner suburb of Brøndbyvester. BK Frem is based in the southern part of Copenhagen (Sydhavnen, Valby). Other teams are FC Nordsjælland (from suburban Farum), Fremad Amager, B93, AB, Lyngby and Hvidovre IF. [255]

    Copenhagen has several handball teams—a sport which is particularly popular in Denmark. Of clubs playing in the "highest" leagues, there are Ajax, Ydun, and HIK (Hellerup). [255] The København Håndbold women's club has recently been established. [256] Copenhagen also has ice hockey teams, of which three play in the top league, Rødovre Mighty Bulls, Herlev Eagles and Hvidovre Ligahockey all inner suburban clubs. Copenhagen Ice Skating Club founded in 1869 is the oldest ice hockey team in Denmark but is no longer in the top league. [257]

    Rugby union is also played in the Danish capital with teams such as CSR-Nanok, Copenhagen Business School Sport Rugby, Frederiksberg RK, Exiles RUFC and Rugbyklubben Speed. Rugby league is now played in Copenhagen, with the national team playing out of Gentofte Stadion. The Danish Australian Football League, based in Copenhagen is the largest Australian rules football competition outside of the English-speaking world. [255] [258]

    Copenhagen Marathon, Copenhagen's annual marathon event, was established in 1980. [259] Round Christiansborg Open Water Swim Race is a 2-kilometre (1.2-mile) open water swimming competition taking place each year in late August. [260] This amateur event is combined with a 10-kilometre (6-mile) Danish championship. [261] In 2009 the event included a 10-kilometre (6-mile) FINA World Cup competition in the morning. Copenhagen hosted the 2011 UCI Road World Championships in September 2011, taking advantage of its bicycle-friendly infrastructure. It was the first time that Denmark had hosted the event since 1956, when it was also held in Copenhagen. [262]

    Airport Edit

    The greater Copenhagen area has a very well established transportation infrastructure making it a hub in Northern Europe. Copenhagen Airport, opened in 1925, is Scandinavia's largest airport, located in Kastrup on the island of Amager. It is connected to the city centre by metro and main line railway services. [263] October 2013 was a record month with 2.2 million passengers, and November 2013 figures reveal that the number of passengers is increasing by some 3% annually, about 50% more than the European average. [264]

    Road, rail and ferry Edit

    Copenhagen has an extensive road network including motorways connecting the city to other parts of Denmark and to Sweden over the Øresund Bridge. [265] The car is still the most popular form of transport within the city itself, representing two-thirds of all distances travelled. This can however lead to serious congestion in rush hour traffic. [266] The Øresund train links Copenhagen with Malmö 24 hours a day, 7 days a week. Copenhagen is also served by a daily ferry connection to Oslo in Norway. [267] In 2012, Copenhagen Harbour handled 372 cruise ships and 840,000 passengers. [267]

    The Copenhagen S-Train, Copenhagen Metro and the regional train networks are used by about half of the city's passengers, the remainder using bus services. Nørreport Station near the city centre serves passengers travelling by main-line rail, S-train, regional train, metro and bus. Some 750,000 passengers make use of public transport facilities every day. [265] Copenhagen Central Station is the hub of the DSB railway network serving Denmark and international destinations. [268]

    The Copenhagen Metro expanded radically with the opening of the City Circle Line (M3) on September 29, 2019. [269] The new line connects all inner boroughs of the city by metro, including the Central Station, and opens up 17 new stations [270] for Copenhageners. On March 28, 2020, the 2.2 km (1.4 mi) Nordhavn extension of the Harbour Line (M4) opened. [271] Running from Copenhagen Central Station, the new extension is a branch line of M3 Cityring to Osterport. [272] The M4 Sydhavn branch is expected to open in 2024. [273] The new metro lines are part of the city's strategy to transform mobility towards sustainable modes of transport such as public transport and cycling as opposed to automobility. [274]

    Copenhagen is cited by urban planners for its exemplary integration of public transport and urban development. In implementing its Finger Plan, Copenhagen is considered the world's first example of a transit metropolis, [50] and areas around S-Train stations like Ballerup and Brøndby Strand are among the earliest examples of transit-oriented development.

    Cycling Edit

    Copenhagen has been rated as the most bicycle-friendly city in the world since 2015, with bicycles outnumbering its inhabitants. [275] [276] [277] In 2012 some 36% of all working or studying city-dwellers cycled to work, school, or university. With 1.27 million km covered every working day by Copenhagen's cyclists (including both residents and commuters), and 75% of Copenhageners cycling throughout the year. [278] The city's bicycle paths are extensive and well used, boasting 400 kilometres (250 miles) of cycle lanes not shared with cars or pedestrians, and sometimes have their own signal systems – giving the cyclists a lead of a couple of seconds to accelerate. [277] [279]

    Promoting health is an important issue for Copenhagen's municipal authorities. Central to its sustainability mission is its "Long Live Copenhagen" (Længe Leve København) scheme in which it has the goal of increasing the life expectancy of citizens, improving quality of life through better standards of health, and encouraging more productive lives and equal opportunities. [280] The city has targets to encourage people to exercise regularly and to reduce the number who smoke and consume alcohol. [280]

    Copenhagen University Hospital forms a conglomerate of several hospitals in Region Hovedstaden and Region Sjælland, together with the faculty of health sciences at the University of Copenhagen Rigshospitalet and Bispebjerg Hospital in Copenhagen belong to this group of university hospitals. [281] Rigshospitalet began operating in March 1757 as Frederiks Hospital, [282] and became state-owned in 1903. With 1,120 beds, Rigshospitalet has responsibility for 65,000 inpatients and approximately 420,000 outpatients annually. It seeks to be the number one specialist hospital in the country, with an extensive team of researchers into cancer treatment, surgery and radiotherapy. [283] In addition to its 8,000 personnel, the hospital has training and hosting functions. It benefits from the presence of in-service students of medicine and other healthcare sciences, as well as scientists working under a variety of research grants. The hospital became internationally famous as the location of Lars von Trier's television horror mini-series The Kingdom. Bispebjerg Hospital was built in 1913, and serves about 400,000 people in the Greater Copenhagen area, with some 3,000 employees. [284] Other large hospitals in the city include Amager Hospital (1997), [285] Herlev Hospital (1976), [286] Hvidovre Hospital (1970), [287] and Gentofte Hospital (1927). [288]

    Many Danish media corporations are located in Copenhagen. DR, the major Danish public service broadcasting corporation consolidated its activities in a new headquarters, DR Byen, in 2006 and 2007. Similarly TV2, which is based in Odense, has concentrated its Copenhagen activities in a modern media house in Teglholmen. [289] The two national daily newspapers Politiken and Berlingske and the two tabloids Ekstra Bladet and BT are based in Copenhagen. [290] Kristeligt Dagblad is based in Copenhagen and is published six days a week. [291] Other important media corporations include Aller Media which is the largest publisher of weekly and monthly magazines in Scandinavia, [292] the Egmont media group [293] and Gyldendal, the largest Danish publisher of books. [294]

    Copenhagen has a large film and television industry. Nordisk Film, established in Valby, Copenhagen in 1906 is the oldest continuously operating film production company in the world. [233] In 1992 it merged with the Egmont media group and currently runs the 17-screen Palads Cinema in Copenhagen. Filmbyen (movie city), located in a former military camp in the suburb of Hvidovre, houses several movie companies and studios. Zentropa is a film company, co-owned by Danish director Lars von Trier. He is behind several international movie productions as well and founded the Dogme Movement. [295] CPH:PIX is Copenhagen's international feature film festival, established in 2009 as a fusion of the 20-year-old NatFilm Festival and the four-year-old CIFF. The CPH:PIX festival takes place in mid-April. CPH:DOX is Copenhagen's international documentary film festival, every year in November. In addition to a documentary film programme of over 100 films, CPH:DOX includes a wide event programme with dozens of events, concerts, exhibitions and parties all over town. [296]

    People awarded the honorary citizenship of Copenhagen are:

    Date Name Notes
    21 November 1838 Bertel Thorvaldsen (1770–1844) Danish sculptor [299]

    While honorary citizenship is no longer granted in Copenhagen, three people have been awarded the title of honorary Copenhageners (æreskøbenhavnere).


    Record Week: Search One Billion Census Records for Free!

    In celebration of our recent milestone — surpassing 8 billion historical records on SuperSearch — we’re happy to announce that we’re making all of our major census collections from the U.S., U.K. and Ireland, Canada, and Nordic countries free for all users for one week!

    Starting on Monday, August 14 , and for a period of one week , no Data subscription will be required, and you can search through this treasure trove of census records for free. That’s 94 collections, containing over 1 billion census records!

    With our earliest census records dating as far back as 1657, and the latest ones extending until 1940, these records are an excellent way to learn more about the lives of your ancestors and to add details to your family tree.

    What can census records reveal about your family?

    Census records contain valuable information just waiting to be discovered. They provide a unique view into the lives of your ancestors at the time of the census, making them a basic foundation of your family history research.

    Each record typically includes details such as the names of household members, ages, places of birth, residence, occupation, immigration, citizenship details, marriage information, military service and more. Some countries recorded religious affiliation as well.

    Used by governments worldwide to enumerate populations, in the world of genealogy, census records can reveal information about the daily lives of your ancestors that can be added to your family tree. Families can be traced from each census over the years, and often from location to location throughout the country.

    Census records can also lead to new connections and relatives. You may be searching for one ancestor and discover additional family members or friends living in the same household whom you knew nothing about.

    Which records are free on MyHeritage?

    Countries US

    U.K. & Ireland
    Canada

    Sweden

    Finland

    Denmark

    Number of census records700,465,273213,519,38428,167,68746,583,54633,428,98162,057,547
    Years covered1790 – 19401801 – 19111825 – 19111880 – 19201657 – 19151850 – 1930
    Exclusive to MyHeritage Sweden Household Examination Books, 1880-1920Finland Church Census and Pre-Confirmation Books, 1657-1915Many of the Danish Censuses
    Link to searchSearch U.S. Census Records for FreeSearch U.K. and Ireland Census Records for FreeSearch Canada Census Records for FreeSearch Sweden Census Records for FreeSearch Finland Census Records for FreeSearch Denmark Census Records for Free

    To celebrate our 8 billion records milestone, searching and viewing all of our major census collections is completely free for the week of Aug 14th until Aug 20. This covers more than one billion census records from the U.S., U.K., Ireland, Canada, Sweden, Finland and Denmark. It is available to users of MyHeritage as well as people who have never used MyHeritage before.

    A MyHeritage Data subscription is still required to view records from other collections, and for saving records to your family tree or confirming Record Matches with any collection.

    Don’t miss the opportunity to explore one billion census records for free. If you haven’t used MyHeritage before, this is a perfect opportunity to give it a try.


    Contents

    While haplogroup I1 most likely diverged from I* as early as 27,000 years ago in the Gravettian, so far DNA studies have only been able to locate it in one Mesolithic hunter-gatherer. As of April 2021, only 4 ancient DNA samples from human remains dating to earlier than the Nordic Bronze Age have been assigned to haplogroup I1:

    • The first is a DNA sample from a Scandinavian hunter-gatherer with the label SF11 found on Stora Karlsö on Gotland. SF11 was found to have carried 9 of the 312 SNPs that define haplogroup I1. SF11 was classified as I1-Z2699*. [22][23][24][25] SF11 was not assigned to a specific archaeological culture due to the skeleton being found in the Stora Förvar cave on Stora Karlsö. The skeleton is dated to 5500 BC.
    • The second is an individual sample labelled BAB5 from Neolithic Hungary. [26] BAB5 was found to have carried 1 of the 312 SNPs that define haplogroup I1. BAB5 may also be classified as I1-Z2699*. [27] BAB5 had a genetic affinity to other contemporary Neolithic farmers of Central Europe.
    • Additionally, the third ancient I1 sample is from an individual found in a kurgan burial dating to the late Neolithic Dagger Period in Scandinavia labelled RISE179. [28] RISE179 had a genetic affinity to the populations of the Corded Ware culture and the Unetice culture. [28]
    • The fourth ancient I1 sample predating the Nordic Bronze Age is labelled oll009 and was sequenced in the study titled "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". [29] Oll009 is dated to the Scandinavian late Neolithic and was found in a burial in Sweden. Similar to RISE179, he carried a high percentage of Western Steppe-Herder ancestry and had a genetic affinity to the population of the Battle Axe culture and other populations of the Corded Ware horizon. [30]

    Despite the high frequency of haplogroup I1 in present-day Scandinavians, I1 is completely absent among early agriculturalist DNA samples from Neolithic Scandinavia. [31] [32] [24] Except for a single DNA sample (SF11), it is also absent from Mesolithic hunter-gatherers in Scandinavia. I1 first starts to appear in Scandinavia in notable frequency during the late Neolithic in conjunction with the entrance of groups carrying Western Steppe Herder ancestry into Scandinavia, but does not increase significantly in frequency until the beginning of the Nordic Bronze Age. [28] [33] [34]

    Due to the very low number of ancient DNA samples that have been assigned to I1 that date to earlier than the Nordic Bronze Age, it is currently unknown whether I1 was present as a rare haplogroup among Scandinavian forager cultures such as Pitted Ware before becoming assimilated by the Battle Axe culture, or if it was brought into Scandinavia by incoming groups such as Battle Axe who may have assimilated it from cultures such as the Funnelbeaker culture in Central Europe. Future research will most likely be able to determine which one of these two possible origins turns out to be the case.

    Samples SF11 and BAB5 are unlike other ancient DNA samples assigned to I1 in the sense that they both seem to represent now-extinct branches of I1 that hadn't fully developed into I-M253 yet. They are therefore unlikely to have been ancestral to present-day carriers of I1, who all share a common ancestor that lived around 2570 BC.

    According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in Chalcolithic Europe. [2] A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques. [3]

    In 2007, it was suggested that it initially dispersed from the area that is now Denmark. [13] However, Prof. Dr. Kenneth Nordtvedt, Montana State University, regarding the MRCA, in 2009 wrote in a personal message: "We don't know where that man existed, but the greater lower Elbe basin seems like the heartland of I1".

    Latest results (Sept. 2019) published by Y-Full suggest I1 (I-M253) was formed 27.500 ybp (95 CI: 29.800 ybp – 25.200 ybp) with TMRCA 4.600 ybp (95 CI: 5.200 ybp – 4.000 ybp). Since the most up-to date calculated estimation of TMRCA of I1 is thought to be around 2570 BC, this likely puts the ancestor of all living I1 men somewhere in Central or Northern Europe around that time. The phylogeny of I1 shows the signature of a rapid star-like expansion. [35] [36] This suggests that I1 went from being a rare marker to a rather common one in a rapid burst. [37]

    I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1 [6]

      I-DF29 (DF29/S438) I1a
        I-CTS6364 (CTS6364/Z2336) I1a1
          FGC20030 I1a1a

          I-P109 I1a1b1a1
            I-Y3662 I1a1b1a1e

          • I-Z59 (S246/Z59) I1a2a
            • I-Z60 (S337/Z60, S439/Z61, Z62) I1a2a1
              • I-Z140 (Z140, Z141)
                • I-L338
                • I-F2642 (F2642)
                • I-L1302
                • I-Z2541
                • I-BY151 I1a3a
                  • I-L849.2 I1a3a1
                  • I-BY351 I1a3a2
                      • I-CTS10345
                        • I-Y10994
                        • I-S2077
                          • I-Y2245 (Y2245/PR683)
                            • I-L1237
                              • I-FGC9550
                              • I-S15301
                              • I-CTS6397 I1b1

                              Haplogroup I1, as well as subclades of R1b such as R1b-U106 and subclades of R1a such as R1a-Z284, are strongly associated with Germanic peoples and are linked to the proto-Germanic speakers of the Nordic Bronze Age. [38] [39] Current DNA research indicates that I1 was close to non-existent in most of Europe outside of Scandinavia and northern Germany before the Migration Period. The expansion of I1 is directly tied to that of the Germanic tribes. Starting around 900 BC, Germanic tribes started moving out of southern Scandinavia and northern Germany into the nearby lands between the Elbe and the Oder. Between 600 and 300 BC another wave of Germanics migrated across the Baltic Sea and settled alongside the Vistula. Germanic migration to that area resulted in the formation of the Wielbark culture, which is associated with the Goths. [40]

                              I1-Z63 has been traced to the Kowalewko burial site in Poland which dates to the Roman Iron Age. In 2017 Polish researchers could successfully assign YDNA haplogroups to 16 individuals who were buried at the site. Out of these 16 individuals, 8 belonged to I1. In terms of subclades, three belonged to I-Z63, and in particular subclade I-L1237. [41] The Kowalewko archeological site has been associated with the Wielbark culture. Therefore the subclade I-L1237 of I-Z63 may be seen somewhat as a genetic indicator of the Gothic tribe of late antiquity. I1-Z63 has also been found in a burial associated with Goth and Lombard remains in Collegno, Italy. [42] [43] The cemetery is dated to the late 6th Century and further suggests that I1-Z63 and downstream subclades are linked to early Medieval Gothic migrations.

                              In 2015, a DNA study tested the Y-DNA haplogroups of 12 samples dated to 300-400 AD from Saxony-Anhalt in Germany. 8 of them belonged to haplogroup I1. This DNA evidence is in alignment with the historical migrations of Germanic tribes from Scandinavia to central Europe. [44]

                              Additionally, I1-Z63 was found in the Late Antiquity site Crypta Balbi in Rome, this time with the downstream subclade I-Y7234. [45] Material findings associated with the Lombards have been excavated in Crypta Balbi.

                              The Pla de l'Horta villa near Girona in Spain is located in close proximity to a necropolis with a series of tombs associated with the Visigoths. The grave goods and the typology of the tombs point to a Visigothic origin of the individuals. A small number of individuals buried at the site were sampled for DNA analysis in a 2019 study. One of the samples belonged to haplogroup I1. [46] This finding is in accordance with the common ancestral origin of the Visigoths and the Ostrogoths.

                              The Anglo-Saxon settlement of Britain introduced I1 in the British Isles. [47]

                              During the Viking Age, I-M253 saw another expansion. Margaryan et al. 2020 analyzed 442 Viking world individuals from various archaeological sites in Europe. I-M253 was the most common Y-haplogroup found in the study. Norwegian and Danish Vikings brought more I1 to Britain and Ireland, while Swedish Vikings introduced it to Russia and Ukraine and brought more of it to Finland and Estonia. [48]

                              I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking Age, or modern times. It is found in all places invaded by the Norse.

                              During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the United States, Australia, New Zealand and Canada.

                              Population Sample size I (total) I1 (I-M253) I1a1a (I-M227) Source
                              Albanians (Tirana) 55 21.82%=(12/55) 3.6%=(2/55) 0.0 Battaglia et al. 2008
                              Albanians (North Macedonia) 64 17.2%=(11/64) 4.7%=(3/64) 0.0 Battaglia et al. 2008
                              Albanians (Tirana)
                              Albanians (North Macedonia)
                              55+64=119 19.33%=(23/119) 4.2%=(5/119) 0.0 Battaglia et al. 2008
                              Kosovo Albanians (Pristina) 114 7.96%=(9/114) 5.31%=(6/114) 0.0 Pericic et al. 2005
                              Albanians (Tirana)
                              Albanians (North Macedonia)
                              Kosovo Albanians (Pristina)
                              55+64+114=233 13.73%=(32/233) 4.72%=(11/233) 0.0 Pericic et al. 2005
                              Battaglia et al. 2008
                              Austria 43 9.3 2.3 0.0 Underhill et al. 2007
                              Belarus: Vitbsk 100 15 1.0 0.0 Underhill et al. 2007
                              Belarus: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
                              Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
                              Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
                              Czech Republic 47 31.9 8.5 0.0 Underhill et al. 2007
                              Czech Republic 53 17.0 1.9 0.0 Rootsi et al. 2004
                              Denmark 122 39.3% (48/122) 32.8% (40/122) 0.0 Underhill et al. 2007
                              England 104 19.2 15.4 0.0 Underhill et al. 2007
                              Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
                              Estonia 118 11.9 Lappalainen et al. 2008
                              Finland (national) 28.0 Lappalainen et al. 2006
                              Finland: West 230 40% (92/230) Lappalainen et al. 2008
                              Finland: East 306 19% (58/306) Lappalainen et al. 2008
                              Finland: Satakunta region 50+ Lappalainen et al. 20089
                              France 58 17.2 8.6 1.7 Underhill et al. 2007
                              France 12 16.7 16.7 0.0 Cann et al. 2002
                              France (Low Normandy) 42 21.4 11.9 0.0 Rootsi et al. 2004
                              Germany 125 24 15.2 0.0 Underhill et al. 2007
                              Greece 171 15.8 2.3 0.0 Underhill et al. 2007
                              Hungary 113 25.7 13.3 0.0 Rootsi et al. 2004
                              Ireland 100 11 6.0 0.0 Underhill et al. 2007
                              Kazan Tatars 53 13.2 11.3 0.0 Trofimova 2015
                              Latvia 113 3.5 Lappalainen et al. 2008
                              Lithuania 164 4.9 Lappalainen et al. 2008
                              Netherlands 93 20.4 14 0.0 Underhill et al. 2007
                              Norway 1766 37% (653/1766) Stenersen et al 2006
                              Russia (national) 16 25 12.5 0.0 Cann et al. 2002
                              Russia: Pskov 130 16.9 5.4 0.0 Underhill et al. 2007
                              Russia: Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
                              Russia: Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
                              Russia: Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
                              Russia: Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
                              Russia: Cossacks 89 24.7 4.5 0.0 Underhill et al. 2007
                              Russia: Karelians 140 10 8.6 0.0 Underhill et al. 2007
                              Russia: Karelians 132 15.2 Lappalainen et al. 2008
                              Russia: Vepsa 39 5.1 2.6 0.0 Underhill et al. 2007
                              Slovakia 70 14.3 4.3 0.0 Rootsi et al. 2004
                              Slovenia 95 26.3 7.4 0.0 Underhill et al. 2007
                              Sweden (national) 160 35.6% (57/160) Lappalainen et al. 2008
                              Sweden (national) 38.0 Lappalainen et al. 2009
                              Sweden: Västra Götaland 52 Lappalainen et al. 2009
                              Switzerland 144 7.6 5.6 0.0 Rootsi et al. 2004
                              Turkey 523 5.4 1.1 0.0 Underhill et al. 2007
                              Ukraine: Lviv 101 23.8 4.9 0.0 Underhill et al. 2007
                              Ukraine: Ivanovo-Frankiv 56 21.4 1.8 0.0 Underhill et al. 2007
                              Ukraine: Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
                              Ukraine: Cherkasy 114 28.1 4.3 0.0 Underhill et al. 2007
                              Ukraine: Bilhorod 56 26.8 5.3 0.0 Underhill et al. 2007

                              In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I1 in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period. [49] The authors assumed that populations with large proportions of haplogroup I1 originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was

                              that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number … This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea … These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.

                              In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues. [50] This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I1 frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.

                              Alexander Hamilton, through genealogy and the testing of his descendants (assuming actual paternity matching his genealogy), has been placed within Y-DNA haplogroup I-M253. [51]

                              The Varangian Šimon, who was said to have been the founder of the Russian Vorontsov noble family, belonged to haplogroup I1-Y15024. [52] [53] Testing by geneticist Peter Sjölund and FamilyTreeDNA showed that the present-day male members of the Vorontsov family still carry this subclade of I1, and downstream subclades. [54] [55] Some prominent historical members of the Vorontsov family were Prince Mikhail Semyonovich Vorontsov, a Russian prince and field-marshal, as well as Count Illarion Ivanovich Vorontsov-Dashkov, a general of the Russian Empire.

                              The Rurikid Prince Sviatopolk the Accursed (son of Vladimir the Great) was found to likely have carried the I1-S2077 subclade of I1-Z63. [56] [57] [58]

                              Birger Jarl, 'Duke of Sweden' of the East Geatish House of Bjälbo, founder of Stockholm his remains were exhumed and tested in 2002 and found to be I-M253. [59] The House of Bjälbo also provided three kings of Norway, and one king of Denmark in the 14th century.

                              Sting was revealed to belong to haplogroup I1 by the PBS TV series Finding Your Roots. [60]

                              William Bradford (governor) of the Mayflower, proven through the Mayflower DNA Project [61]

                              William Brewster (Mayflower passenger) of the Mayflower, proven through the Mayflower DNA Project [61]

                              General Robert E. Lee belonged to I-M253 based on DNA testing of his descendants as a part of the Lee DNA Project. Other prominent members of the Lee family of Virginia and Maryland were Richard Lee I and Richard Henry Lee. The latter was one of the Founding Fathers of the United States of America. [62]

                              Robert I of Scotland, commonly known as Robert the Bruce, belonged to haplogroup I1. Descendant testing of Robert, 6th lord of Annandale de Brus, assigned the men of Clan Bruce to I1-Y17395. [63]

                              The male members of the House of Grimaldi were revealed to carry haplogroup I1 as a part of the Grimaldi Genealogy DNA project. [64] They were lords and princes of Monaco up until 1949. The men of House Grimaldi belong to a Scandinavian subclade of I1, downstream of I1-Y3549.

                              President Andrew Jackson belonged to haplogroup I1, based on results from the Jackson DNA project and from genealogy. [65] [66]

                              The Russian writer Leo Tolstoy was found to have carried I1. The testing of his male descendant Pyotr Tolstoy revealed that the males of the Tolstoy family carry I1-M253. [67] [68]

                              Snorri Sturluson was found to likely have belonged to haplogroup I1. Y-DNA testing of his presumed descendants revealed an assignment to I-M253. Their results are available on YSearch.org. [67]

                              The Swedish scientist and theologian Emanuel Swedenborg and other male members of the Swedenborg noble family were found to belong to haplogroup I1-BY229, as a part of the I1-L1302 DNA project by Jakob Norstedt. [69] [70]

                              Siener van Rensburg, Boer patriotic figure and mystic, belonged to haplogroup I1. [71] [72]

                              Björn Wahlroos, Finnish businessman and millionaire, was found to belong to haplogroup I1. [67]

                              The Finnish mathematician Rolf Nevanlinna belonged to I1-M253 based on the testing of his son Arne Nevanlinna by Geni.com. [73] [74] [75]

                              Samuel Morse was found to have carried haplogroup I1 as a part of the Morse DNA project. [76] [77] [78]

                              Footballers Sebastian Larsson and his father Svante Larsson were found to belong to I1-Y24470 through the testing of a family member. [79] [80] [81] [82]

                              Felix Kjellberg (PewDiePie) was found to belong to haplogroup I1-L22, according to testing by 23andMe. [83]

                              Swedish actor Björn Andrésen belongs to haplogroup I1-L22 based on the ftDNA and 23andMe tests of one of his first cousins and one uncle on the paternal side as a part of their family research. [84] [85] [86] [87] Their ancestor Johan Andrésen lived on both sides of the Swedish-Norwegian border. [88] [89]

                              As a part of the Pine family DNA project, actor Chris Pine was found to belong to haplogroup I1-A13819. [90] [91]

                              The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.

                              Type: SNP Source: M (Peter Underhill of Stanford University) Position: ChrY:13532101..13532101 (+ strand) Position (base pair): 283 Total size (base pairs): 400 Length: 1 ISOGG HG: I1 Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT YCC HG: I1 Nucleotide alleles change (mutation): C to T

                              Type: SNP Source: M (Peter Underhill) Position: ChrY:21160339..21160339 (+ strand) Length: 1 ISOGG HG: I1 Primer F: TTATTGGCATTTCAGGAAGTG Primer R: GGGTGAGGCAGGAAAATAGC YCC HG: I1 Nucleotide alleles change (mutation): G to A

                              Type: SNP Source: PS (Michael Hammer of the University of Arizona and James F. Wilson, at the University of Edinburgh) Position: ChrY:13006761..13006761 (+ strand) Length: 1 ISOGG HG: I1 Primer F: GGTGGGCTGTTTGAAAAAGA Primer R: AGCCAAATACCAGTCGTCAC YCC HG: I1 Nucleotide alleles change (mutation): G to A Region: ARSDP

                              Type: SNP Source: PS (Michael Hammer and James F. Wilson) Position: ChrY:12994402..12994402 (+ strand) Length: 1 ISOGG HG: I1 Primer F: GGAGAAAAGGTGAGAAACC Primer R: GGACAAGGGGCAGATT YCC HG: I1 Nucleotide alleles change (mutation): C to T Region: ARSDP


                              Wolves, but no dogs, in Scandinavian wolf population’s heritage

                              Scandinavia&rsquos roughly 400 wolves, straddling the border between Norway and Sweden, have aroused controversy almost from the moment a breeding pair came to the region in the 1980s.

                              The key issue revolves around protecting the animals, which have been listed by Norway as critically endangered since 2015.

                              Some opponents of how the Norwegian government manages its wolf population have questioned if the animals are a pure wolf species, or if they have interbred with dogs. If Scandinavian wolves were in fact part dog, that might affect the need to protect them.

                              But new research shows that the Scandinavian wolf population has its origins in wolves that previously lived in the Nordic parts of Europe.

                              &ldquoThe lines of descent found in the Scandinavian wolf population haven&rsquot been found in any dogs,&rdquo Hans Ellegren, a professor of evolutionary biology from Uppsala University, said in a press release. Ellegren was head of the group that conducted the study.

                              Tracing origins via DNA

                              In all mammals, the Y chromosome is inherited from father to son. This pattern of inheritance, called a patriline, makes it possible to follow the father&rsquos genetic line far back in time. Researchers used this fact to trace the origin of today&rsquos wolves.

                              Linnéa Smeds, a bioinformatist and doctoral student at Uppsala University&rsquos Evolutionary Biology Centre, mapped the composition of the wolf&rsquos Y chromosome. She then compared Y chromosomes from wolves from Scandinavia, Finland and other parts of the world, as well as from dogs.

                              Interbreeding between wolves and dogs is known from many parts of the world. These wolf-dog hybrids are generally the result of male dogs mating with female wolves.

                              One such animal was found in Katrineholm outside of Stockholm, in 2017, while another was found in Oslo 20 years ago.

                              As a result, the Norwegian Storting has raised the question of whether there is any genetic evidence of dogs interbreeding with the wolves that returned to Scandinavia in the 1980s, after the animals had been virtually extinct.

                              Origins in the region

                              The new genetic results show no evidence of crosses between wolves and dogs in today&rsquos Scandinavian wolf population.

                              These animals share the patrilines that are found in the Finnish wolf, but not in wolves from other parts of the world, and not in dogs.

                              &ldquoSo it&rsquos plausible that the Scandinavian wolf population, at least in the male line of descent, is of regional origin. There may, for instance, have been migrating wolves or wolves quite simply remaining from the population that once ranged throughout Scandinavia,&rdquo Ellegren is quoted as saying in the press release.

                              Confirms earlier study

                              &ldquoThe results from Ellegren's new study are fully in line with the conclusions in a study from 2003, where we examined the origin of the Scandinavian wolf population,&rdquo says senior scientist Øystein Flagstad, at the Norwegian Institute for Natural Research.

                              Both studies concluded that the Scandinavian wolf population has a Finnish-Russian origin.

                              &ldquoThe new thing here is that they have obtained data from the entire Y chromosome, and not just used genetic markers as was done previously,&rdquo Flagstad said.

                              &ldquoThe probability that the Scandinavian wolf has its origins in Finnish-Russian stock is overwhelming. This finding is further strengthened by this study,&rdquo he said.

                              Additionally, researchers have compiled a near complete family tree for the entire Scandinavian wolf population, he says, &ldquowhich shows that there is no element of dog in the Scandinavian wolf population.&rdquo

                              Related content